- Home
- Conference Proceedings
- Qatar Foundation Annual Research Conference Proceedings
- Conference Proceeding
Qatar Foundation Annual Research Conference Proceedings Volume 2016 Issue 1
- Conference date: 22-23 Mar 2016
- Location: Qatar National Convention Center (QNCC), Doha, Qatar
- Volume number: 2016
- Published: 21 March 2016
351 - 400 of 656 results
-
-
CD4+T Cells Are Programmed to Differentiate Before Entry into Division
Authors: Nicholas Van Panhuys, Douglas Palmer and Ronald GermainIn order to provide a protective host response to a vast array of invading pathological microorganisms the ability of naïve CD4+T cells to differentiate into discrete effector subsets, each able to mediate specific aspects of immunity is a central tenet of the adaptive immune response. T helper (Th) 1 cells mediate protection against intracellular pathogens, such as bacterial and viral infections, whereas Th2 cells mediate protective responses against extracellular pathogens such as helminthic parasites. Additionally, naive T cells may be induced to differentiate into T regulatory (Treg) cells, with Treg cells serving as an immunological checkpoint to dampen the immune response and protect against inappropriate activation of the immune system. As in the case of autoimmune diseases where aberrant Th1 cell differentiation occurs in response to self antigens or in the case of asthma and allergic responses where aberrant Th2 cell differentiation occurs in response to non-self environmental antigens. In order to activate naïve T cells and induce them to differentiate to combat a specific invading pathogen dendritic cells (DC), which are present throughout the body serving as cellular sentinels constantly surveying there surrounding for evidence of infection must be activated. Activation of DC occurs through ligand mediated activation of pathogen associated molecular pattern receptors or danger associated molecular pattern receptors. Allowing for the engagement of specific downstream patterns of effector molecule regulation that play an instructive role in the decision making process which occurs during the activation, division and differentiation of naïve T cells. Current dogma suggests that the generation of differentiated effector CD4+T cells takes place over a 3–4 day period following the initial engagement of the T cell receptor (TCR). Activation of CD4+T cells is thought to occur in three distinct functional phases, priming, proliferation and differentiation. Through the use of an in vitro culture system that allows for precise control of the factors which regulate the activation of naïve CD4+T cells we initially assessed the requirements for cytokine signaling vs. strength of TCR signaling during differentiation. Here, we determined that Th2 differentiation can be driven following activation with a weak TCR stimuli in the absence of additional cytokine inputs, indicating that Th2 differentiation occurs through a default endogenous pathway following activation. Whereas, Th1 differentiation required both a strong TCR signal and the presence of an instructive cytokine, in this case IFNg in order for differentiation to occur. We additionally investigated the kinetics of upregulation of the master transcription factors that regulate commitment to a specific T-helper phenotype. CD4+T cells acquire the disposition to commit to either Th1, Th2 or Treg lineages very soon after activation >24 hr and prior to the induction of division, as evidenced by increased expression of the master transcription factor proteins Tbet, GATA3 or Foxp3. Further, we show that entrance into cellular division is not required for the induction of a full program of differentiation to occur. By interrupting the activation of naïve CD4+T cells at different time points following stimulation through the use of anti-MHCII antibody. We were able to probe the effects that both alteration of TCR signal strength and alteration of TCR signal length have on the induction of differentiation as compared to division. This approach allowed us to demonstrate that TCR signaling is responsible for two distinct activation programs, whereby the strength of signal that a naïve T cell receives working in concert with or without cytokine at an early phase can induce Th1 or Th2 differentiation respectively. Whereas the length of the TCR signal can be construed as a secondary component of activation which controls the ability of CD4+T cells to enter into division. Here, we determined that at low concentrations of antigen TCR signaling must occur for 2 hr. Demonstrating that the signal delivered through the TCR represents not only an essential component for inducing an immune response through the initial activation of naïve CD4+T cells, but also acts as a rheostat that is able to determine both the strength and the length of TCR signal received. In turn controlling cellular decision making by dictating the outcome of differentiation and whether a cell will enter into cycle. As such these results have important implications for the rational design of vaccination strategies, in order to modulate components of TCR signaling cascade to direct an optimal response against the target vaccine antigens.
-
-
-
OFD1 Missense Mutation Causes an Autosomal Recessive Dyskeratosis Congenita-Like Disorder Further Complicating the Clinical Heterogeneity of OFD1 Mutations
Authors: Marios Kambouris, Hibah Shaath, Abeer Fadda, Yasser Al-Sarraj, Sara Tomei, Wang Ena and Hatem El-ShantiA consanguineous [first cousin marriage] family of Arabic ethnic origin with four unaffected siblings and two male siblings affected by a Dyskeratosis Congenita-like disorder, was studied by Genome-Wide SNP homozygosity mapping, functional and positional candidate gene screening by Sanger sequencing, and Whole Genome Sequencing [WGS] to identify the offending gene and mutation. The disorder is marked by short stature, sparse hair including eyelashes, leukoplakia, dental carries and early tooth loss, osteoporosis, skin atrophy and hyper pigmentation, nail dystrophy with longitudinal ridging and splitting without bone marrow involvement.
The offending gene was mapped to two possible homozygous genomic regions on chromosomes 3p and 6q cumulatively spanning 24 Mb containing 86 protein-coding genes. Functional and positional candidate gene screening by Sanger sequencing for ARL6IP, BCKDHB, DKC1, DNAH17, EEF1A1, LRIG1, ORC3, POLA1, SLC17A5 and SYNCRIP did not identify causative pathogenic mutations. Analyses and mining of WGS data for homozygous variants within the homozygous regions and Xlinked variants [as only males are affected] in X-shared regions among affected siblings, identified a homozygous missense c.C2353T/p.P785S mutation in the OFD1 gene, at Xp22.2. The mutation co-segregates with the disease phenotype within the family, is absent in all public databases and in 500 ethnically matched control chromosomes. OFD1 is a 1012 aa protein component of centrioles, controlling centriole length and involved in cilium biogenesis. OFD1 mutations cause Oral-facial-digital syndrome 1, Simpson-Golabi-Behmel Syndrome Type 2, Joubert Syndrome 10 and Retinitis Pigmentosa 23 displaying significant phenotypic heterogeneity and clinical variability. The c.C2353T/p.P785S mutation ads a Dyskeratosis Congenita-like phenotype to the wide spectrum of OFD1 disease phenotypes. In addition, it demonstrates that when applying WGS data to clinical diagnoses, all significant variants should be considered and scrutinized for their clinical impact, irrespective of the observed clinical presentation.
-
-
-
Differential Responsiveness to Braf Inhibitors of Melanoma Cell Lines Braf V600e-Mutated
Background
Melanoma is an aggressive neoplasm characterized by a complex etiology. Several molecular alterations occur during melanoma progression. The most commonly mutated pathway is the mitogen-activated protein kinases (MAPK)/ERK cascade. The activation of the MAPK/ERK signaling occurs either through gain-of-function mutations in BRAF and NRAS gene or through autocrine growth factor stimulation. Documented mutations have been found in the kinase domain of BRAF gene encoded by exon 11 and 15 with a frequency of 50–70%. The majority of these mutations affect one critical amino acid, resulting in the V600E substitution which account for more than 90% of all BRAF mutations. Given the high incidence of BRAF V600E mutation in melanoma, patient management is based on the use of specific inhibitors when patients carry BRAF V600E mutation.
By comparing RNA-seq and DNA Sanger sequencing data, we found that among 15 melanoma cell lines 3 were discordant in the mutation detection (BRAF V600E at DNA level/Sanger sequencing and BRAF WT on RNA-seq). We initially postulated that those cell lines may express only the WT allele at the RNA level although mutated at the DNA level. A more careful analysis showed that these cell lines express very low level of BRAF RNA and the expression may be in favor of the WT allele.
Given the low BRAF V600E RNA expression, we tested in this study whether the three discordant cell lines may respond differently to BRAF-specific inhibitors compared to the concordant BRAF WT and BRAF V600E control cell lines.
Methods
The three discordant cell lines, one BRAF V600E and one BRAF WT control cell lines were treated with three BRAF inhibitors, including two BRAF V600E specific (vemurafenib and PLX4720) and one aspecific (sorafenib).
Measurement of cell proliferation was performed by MTT assay. Quantitative real time PCR and Western Blot were also performed to detect BRAF V600E RNA and protein expression and to assess MAPK pathway activation.
Results
The three discordant cell lines showed BRAF V600E expression both at the RNA and protein level and MAPK pathway activation although at a lower level as compared to the BRAF V600E control cell line. The proliferation rate of the discordant cell lines decreased after treatment with vemurafenib and PLX4720 but was not affected by treatment with sorafenib, suggesting a BRAF V600E biological behavior. Yet, responsiveness to the BRAF specific inhibitors was lower as compared to the BRAF V600E control.
All together these data suggest that the cell lines carrying BRAF V600E mutations at the DNA level may respond differently to BRAF targeted treatment and the differential responsiveness may be related to a lower BRAF V600E RNA and protein expression.
-
-
-
Putative Relation Between Autism Spectrum Disease & Hereditary Multiple Exostosis Investigated by Whole Genome Sequencing & Comparative Genome Analyses in a Family with ASD and HME with EXT-1 Mutations
Authors: Marios Kambouris, Abeer Fadda, Yasser Al-Sarraj, Dina Ahram, Sara Tomei, Ena Wang and Hatem El-ShantiA family with two male children affected with ASD and HME as well as an unaffected female child, was studied to identify the Genetic basis of ASD in the family and the possible relation between ASD & HME.
Irie et al., [PNAS, 109: 5052–5056, 2012] reported that Heparan Sulfate deficient mice due to inactivating EXT-1 mutations exhibit Autism-like socio-communicative deficits and stereotypies suggesting a relation between MHE and ASD. The father and both male children are clinically affected by HME and carry the known pathogenic EXT-1 c.C1018T/p.R340C dominant mutation. Both male children are also affected by ASD; the father is not. The mother and the female child are not affected either by HME or ASD and do not carry the EXT-1 mutation.
Whole-Genome SNP genotyping and CNV analyses did not detect aneuploidy or deletion/duplication defects as possible ASD causes. WGNGS for all members, comparative genome analyses and data mining were as follows: [Only exonic variants considered, prioritized according to increasing population frequency (0–1%), damaging effects according to mutation prediction models and will be presented in table format].
1. The two ASD events are unrelated and are due to de-novo variants. Trio analyses identified 72 de-novo variants in the first affected child and 56 in the second. Twelve were in common
2. The two ASD events are due to heterozygous variants inherited from both parents which in synergy exceed a disease onset threshold in the affected offspring. Eighty father-to-son and 69 mother-to-son heterozygous variants shared between the affected males were identified.
4. The HME unaffected parent [mother] contributed heterozygous variants in the Heparan Sulfate biosynthesis pathway that in synergy with the EXT-1 mutation could be the genetic causes of ASD in the family.
WGNGS and comparative genome analyses were utilized to decipher the possible relationship between HME and ASD in this unique family with members affected by both disorders.
-
-
-
Monoallelic Expression in Melanoma
Background
Monoallelic expression (MAE) is a frequent genomic phenomenon in normal tissues, however its role in cancer is yet to be fully understood. MAE is defined as the expression of a gene that is restricted to one allele in the presence of a diploid heterozygous genome. Constitutive MAE occur for imprinted genes, odorant receptors and random X inactivation. Several studies in normal tissues have showed MAE in about 5–20% of the cases. However, little information exists on the MAE rate in cancer. In this study we assessed the presence and rate of MAE in melanoma. The genetic basis of melanoma has been studied in depth over the past decades, leading to the identification of mutations/genetic alterations responsible for melanoma development. To examine the role of MAE in melanoma we used 15 melanoma cell lines and compared their RNA-seq data with genotyping data obtained by the parental TIL (tumor infiltrating lymphocytes).
Methods
Genotyping was performed by Illumina HumanOmni1 beadchip. For the RNA-seq experiment, library preparation and sequencing was performed using the Illumina TruSeq Stranded Total RNA Human Kit and subsequently sequenced using a HiSeq 2500 according to manufacturer's guidelines. Genotype calling and subsequent quality filtering was performed in Illumina's Genome Studio software. IMPUTE2 (University of Oxford) was used for imputation of the genotyped data. RNA-Seq analysis was performed using the Broad Best Practice Workflows for RNA-Seq with the exception that a genotype was created for every available base pair in order to compare to the genotyped array data. In house custom perl scripts were then created to compare the genotyping data to the processed RNA-Seq data. The genotype and the B-allele frequency were calculated the latter creating a range of expression to evaluate.
By comparing genotyping data with RNA-seq data, we identified SNPs in which DNA genotypes were heterozygous and corresponding RNA genotypes were homozygous. All homozygous DNA genotypes were removed prior to the analysis. To confirm the validity to detect MAE, we examined heterozygous DNA genotypes from X chromosome of female samples as well as for imprinted and olfactory receptor genes and confirmed MAE.
Results
MAE was detected in all 15 cell lines although to a different rate (spanning from approximately 17% to 75% MAE). When looking at the B-allele frequencies we found a preferential pattern of complete monoallelic expression rather then differential monoallelic expression across the 15 melanoma cell lines. As some samples showed high differences in the homozygous and heterozygous call rate, we looked at the single chromosomes and showed that MAE may be explained by underlying large copy number imbalances and isodisomy in some instances. Nevertheless, some chromosome regions showed MAE without CN imbalances suggesting that additional mechanisms (including epigenetic silencing) may explain MAE in melanoma.
Conclusion
The biological implications of MAE are yet to be realized. Nevertheless our findings suggest that MAE is a common phenomenon in melanoma cell lines. Further analyses are currently being undertaken to evaluate whether MAE is gene/pathway specific and to understand whether MAE can be employed by cancers to achieve a more aggressive phenotype.
-
-
-
An Experimental Approach for Studying the Effects of Environmental Factors on Brain Circulation
More LessThe main function of the circulatory system is to circulate blood in vessels. Formation of blood clots adversely affects blood flow and may cause stoppage if a vessel is blocked. Damage to brain cells results when blood flow stops – as there would be no oxygen or glucose delivered. Damage to brain cells is irreversible – thus, it is crucial that brain circulation would be intact and normally-functioning. Experimental work involved several studies in which a well-established model for induction of blood clots in brain vessels in mice was utilized. The technique involves performing a microsurgery on anesthetized mice to expose the brain surface and the removal of the dura mater to expose blood micro-vessels. Mice are warmed to 37°C and the exposed brain is irrigated with warmed (37°C) and circulated artificial cerebrospinal fluid. Experimental mice would be placed on the stage of a fluorescent microscope with an attached camera and a TV monitor and VCR for observations to be made and recorded. Controlled experimental conditions allowed for exact timing of the appearance of the first observed blood clot and the time for total block of blood flow in arteries and veins. A trained observer uses 4 stop watches to times for the first appearance of platelet aggregation and for flow stop. The times recorded by the observer are double-checked through replaying of recorded video tapes. Environmental and nutritional influences on brain circulation were of interest - which included: dehydration by water deprivation, exposure to high temperature, and exposure to lead. Also of interest, was to test drugs and agents that would alleviate the adverse effects of these detrimental factors. Treatments with drugs such as aspirin and with a medicinal plant such as garlic were studied in this effect. Collectively, data of these studies elucidated that dehydration, high temperature and lead had adverse effects on blood clotting processes, while treatments with aspirin and garlic, among others, were beneficial. This presentation involves making recommendations for body hydration and protection from high environmental temperature, particularly for those who are susceptible, such as children, the elderly and outdoor workers. This presentation also urges for utilizing research outcomes and collaboration among concerned entities about human health for best benefits to health and to the society in the long run.
-
-
-
Comparison of Cardiometabolic Risk Factors in Metabolically Healthy and Pathologically Obese Arabs and Caucasians
Background
Obesity related diseases including type 2 diabetes mellitus (T2DM) and non-alcoholic fatty liver disease have become major health problems. Inappropriate insulin production and dyslipidemia are commonly associated with obesity. It is multifactorial and heterogeneous in origin. While 60–80% of obese subjects are insulin resistant (IR) and rapidly develop metabolic diseases, called pathologically obese (PO), a proportion retain sensitivity to the hormone and remain relatively healthy (MHO), either because the progression to disease is slower in these individuals or they have developed pathways that renders them immune. Stratification of this disease, depending on the range of associated pathologies, would help identify mediators, design targeted therapies, in the understanding of mechanisms for this apparent protection. Also some ethnicities, such as South Asians and Arabs, appear susceptible to both obesity and its associated pathologies, perhaps largely determined by lifestyle factors, such as diet and exercise. However weight loss, mainly surgical, is proving to be the most successful means of reducing body weight and improving insulin sensitivity.
Therefore the aims of this study were to compare morbidly obese patients of Caucasian and Arab origin prior to and after weight loss to identify biomarkers of insulin sensitivity and inflammation in Arabs and Caucasians.
Methods
Subjects: Morbidly obese patients of Arab and Caucasian origins awaiting bariatric surgery (gastric bypass, gastric sleeve, or gastric band) were recruited from the pre-operative clinics: Al-Emadi Hospital, Hamad Medical Corporation, (Doha, Qatar) and Whittington Hospital (North London Obesity Surgery Service, Whittington Hospital, London, UK). Morbid obesity was defined as BMI ≥ 40 kg.m− 2 or BMI ≥ 35 kg.m− 2 with significant co-morbidities. All studies were approved by the relevant National Ethics Committees.
The studies included both males and females over the age of 18 years. Patients with coronary artery disease, uncontrolled hypertension, malignancy or terminal illness, connective tissue disease or other inflammatory conditions likely to affect cytokine levels, immuno-compromised subjects and those with substance abuse or other causes for poor compliance were excluded.
Anthropometric measurements were recorded: age (years), weight (kg), and height (m) systolic and diastolic blood pressure (mmHg). BMI was calculated (kg.m− 2). Patient information including demographic data (date of birth, gender, ethnicity), surgery type (gastric bypass, gastric band, gastric sleeve), co-morbidities, current medication, weight loss history, smoking habits and alcohol consumption were recorded from hospital notes.
Samples: Blood samples (EDTA, NaF, no anti-coagulent), following an overnight fast, were drawn from an ante-cubital vein on the day of the operation, immediately after anesthesia. Samples were centrifuged (3000 rpm, 15 minutes, 25°C), and the plasma or serum collected and stored at − 80 °C prior to assay.
Assays: Blood samples were used to determine glucose (hexokinase), lipids (Total Cholesterol, LDL and HDL: Roche) and insulin (ELISA, Mercodia). Adipokines (leptin, adiponectin, interleukin-6, and MCP1) were assayed by ELISA (R&D Systems, Oxon, UK). Insulin resistance was calculated using the homeostatic model assessment where HOMA = (glucose in mmol/L × insulin in miU/ml)/22.5.
The criteria for classification: Subjects were considered MHO if free of T2DM, dyslipidaemia, and cardiovascular disease, and exhibited systolic blood pressure less than 140 mmHg, diastolic blood pressure less than 85 mmHg, fasting plasma glucose less than 6.8 mmol/l and insulin less than 6.5 miU/ml.
Statistics: Data were entered in SPSS version 22.0 for statistical analysis. Parametric tests were used for normally distributed data and non-parametric analysis for skewed data.
Results
Effect of ethnicity on cardiometabolic risk factors.
Despite the Arab cohort being significantly younger, they were hyperglycemic hyperinsulemic and hyperleptinaemic, compared to the Caucasians. This population also had elevated β-cell function and insulin resistance, while insulin sensitivity was lower. However there was no significant difference in blood pressure. Total-, LDL- and HDL-cholesterol were higher, but triglycerides lower, in Arabs. Leptin, a marker of adipose tissue mass and adipocyte hypertrophy, was elevated in Arabs. Furthermore the proinflammatory adipokines (MCP-1, IL-6) were higher and the anti-inflammatory adipokines (adiponectin) lower in this population.
Weight loss
In Caucasians, there was an increase in both HDL- and LDL-cholesterol in the PO group, and in serum adiponectin in both MHO and PO patients, following surgery. However, the insulin levels and HOMA-IR index decreased significantly in the PO group. Fasting plasma glucose did not change after weight loss in either group, whereas the total cholesterol increased in both groups significantly. In Arabs, three months after surgery, both MHO and PO subjects showed significant reduction in BMI, which was accompanied by lower systemic insulin, HOMA-IR and leptin. There was no change in total-, LDL- and HDL-cholesterol, whereas triglycerides were reduced after the weight loss. The inflammatory biomarkers CRP and IL-6 were unchanged.
Conclusion
Despite both populations being equally obese the Arabs had greater prevalence of risk factors for cardio metabolic complications, with fewer having a metabolically healthy phenotype. In non-diabetic Arabs, compared to Caucasians, insulin resistance and inflammation appeared to be predominant lesions. Interestingly higher leptin levels in the BMI-matched Arabs points to adipocyte hypertrophy and adipose tissue dysfunction as causal factors in these lesions. The young age at which Arabs develop obesity perhaps explains the greater susceptibility to its pathological consequences.
-
-
-
Seroprevalence of Toxoplasma Gondii Among Stray Cats in Qatar
Authors: Sonia Boughattas, Aarti Sharma and Marawan Abu-MadiToxoplasmosis is the most widespread infection worldwide due to the parasite Toxoplasma gondii. The protozoan is a ubiquitous pathogen of warm-blooded animals, including man. In man it is responsible for fetal damage and is a common cause of death in acquired immune deficiency syndrome patients, and is therefore considered as a major zoonosis (Dubey 1994). The infection has become a serious public health problem worldwide. It is estimated that about one third of the world population is chronically infected with T. gondii (Montoya et al. 2004, Zhou et al. 2008) The principal horizontal transmission of toxoplasmosis to humans is caused by consuming food or water contaminated with oocysts shed in the feces of infected cats or by eating undercooked meat from animals which have ingested oocysts and developed tissue cysts. (Dubey et al, 2009).
Indeed, Felids, mainly cats (Felis catus), can eliminate millions of environmentally resistant parasite oocysts in their faeces. Cats are often infected at less than 1 year of age where they can contaminate the environment shedding millions of oocysts per day for 1–2 weeks (Dubey, 2001). Stray cats are more likely to be exposed and infected; thereby contributing more frequently to environmental contamination than domestic indoor cats (Ballash et al, 2015). Stray - refers to street, alley, farm or semi dependent cats that may or may not receive some food directly from humans; however they do so indirectly by scavenging scraps from rubbish bins, dump sites or from slaughter remains on farms. No attempt is made to house these animals yet they may inhabit manmade structures such as farm buildings, factories, wharves or abandoned vehicles.
Moreover, the large home range of a feral cat of up to 10 km2 ensures widespread contamination of the environment in a relatively short period, with some cats travelling up to 45 km in two days (Fancourt & Jackson, 2014). Indeed, stray cats are considered as the linkage between wild life and urban life in T. gondii transmission. The prevalence of T. gondii in cats is thought to reflect prevalence of the parasite in animals that cats access for food.
Under favorable climatic conditions privileged by humidity, oocysts develop infectivity in a few days by sporulation and may remain infectious for more than one year in unfrozen, moist soil (Mancianti et al, 2015). Number or presence of cats on farms was the risk factors the often identified in epidemiological studies. An environmental contamination with ooysts derived from infected cats can cause outbreakes of toxoplasmosis (Mullens, 1996; Karanis et al, 2013). Indeed, a large waterborne outbreak of toxoplasmosis in humans was epidemiologically linked to oocyst contamination of a water reservoir in British Columbia, Canada (Bowie et al., 1997).
In Qatar, scarce data are available about the prevalence of the parasite in the environment. Feline patent Toxoplasma-like coccidiosis among feral cats was investigated (Abu Madi & Behnke, 2014). Previous study reported an average seroprevalence rate in human of 29.8% with a progressive rise from 45 years of age (Abu Madi et al, 2008). Such observations provide further evidence for the increased risk of infection with acquisition of age through longer contact with infective parasite from the environment.
Within our current work, we investigated the prevalence of Toxoplasma gondii among stray cats in Qatar with gender, area and seasons correlation analysis.
Feral cats were caught live as part of the routine activities of the QCCU as described elsewhere (Abu Madi & Behnke, 2014). Briefly, trapped adult Cats were eligible for the trap-neuter-return (TNR) program and were transported to a shelter for sterilization, respecting current animal welfare rules. For each animal the GENDER, the AREA and the SEASON of sampling were recorded. Sera were checked to detect T. gondii IgG antibodies using the modified agglutination test (MAT) (Dubey and Desmonts, 1987). A titer of 1:25 or higher was considered indicative of T. gondii infection in cats. SPSS 21.0 statistical package has been used for the analysis.
Antibodies to T. gondii were found in 406 of the 495 (82%) of the stray cats in Qatar with four samples presenting prozone effect with negative result at the low dilution of 1:25 and positive agglutination at high dilutions ≥ 1:1600. The overall seroprevalence, presented in our study, was 82%, which is far more than other reports from neighbor countries where prevalence among stray cats didn't exceed 19.6% in Kuwait (Abdou et al, 2013); 30.4% in Iraq (Switzer et al, 2013) and ranged from 33 to 52% in Turkey depending of the used technique (Ozkan et al, 2008 & Can et al, 2014).
Positive MAT results were found among 82.5% of male, 81.6% of female, 82.4% from urban area and 81.7% from sub-urban localities with no significant difference between the subgroups. The consistent high seroprevalence, in the different sampling areas, demonstrates a high level of T. gondii contamination throughout Doha. The non-significant difference between seroprevalences in male and female cats suggests that both genders are equally exposed and susceptible to infection.
Taken in account the season of sampling, 333 sera form 394 sampled in Summer were positive (84.5%). Anti-T.gondii antibodies were found in 73 of 101 sera sampled in Winter (72.3%). The difference is retained significant (p < 0.005). From the overall seropositive cats, 37.7% have a titer greater that 1:400. The observed high seroprevalence and its significant correlation to season of sampling gives further confirmation of the fact that favourable climatic conditions support long-term oocyst survival in the environment. While oocysts are not infective when first shed, they sporulate and become infective after 1–5 days in the environment and can remain viable at least 18 months under cool and moist areas (Frenkel et al, 1975).
-
-
-
The Role of C-Terminus Cytosolic Domain in the Mechanism of ORAI1 Trafficking and Internalization During Oocyte Maturation
Authors: Maya Dib, Rawad Hodeify and Khaled MachacaStore-operated calcium entry (SOCE) is a ubiquitous Ca2+ influx pathway essential for many physiological functions and failure to maintain normal calcium homeostasis is one of the leading causes of cellular dysfunction in a wide variety of pathological conditions. Orai1, a key regulator of SOCE, constitutively recycles at steady state in the frog oocyte and internalizes into intracellular vesicular compartments during meiosis, leading to inactivation of SOCE. Such mechanism provides proper regulation of Ca2+ signaling in preparation for fertilization and embryonic development. Previous data showed a role for Orai1 C-terminus in its internalization during meiosis. However, the minimal region required for Orai1 internalization at steady state and during meiosis is not known.
We began the study of the molecular determinants of Orai1 trafficking in Xenopus oocytes by comparing the localization of multiple GFP-Orai1 C-terminal mutants 1-266, 1-275, and 1-285 intracellularly. Orai1 mutants 1-275 and 1-285 were both internalized during meiosis behaving similarly to WT, however, Orai1 1-266 was significantly enriched at the plasma membrane and did not internalize during oocyte maturation. To further map the region required for Orai1 internalization, we will generate specific mutants in the region 267-275 and evaluate the contribution of these signals in Orai1 internalization during meiosis. Mutants showing defect in internalization will be tested for phenotype rescue by co-injecting Orai1 with different potential candidates. These proteins include: 1) Rab5, a member of Rab family of GTPases has been shown to play a role as a regulator of intracellular trafficking during endocytosis. Previous data from our group has shown that Rab5 colocalizes with Orai1 in both oocytes and eggs. 2) Caveolin-1, a coat protein mediating caveolin-dependent endocytosis. 3) Flotilin-1, a membrane-associated protein involved in flotilin-dependent endocytosis.
As a second step in exploring the molecular and biochemical mechanisms underlying Orai1 internalization during meiosis, we will identify Orai1 associated proteins by co-immunoprecipitation of Orai1 complexes followed by quantitative proteomic analysis using dimethyl labeling coupled with tandem liquid chromatography-mass spectrometry (LC-MS). Candidates that are enriched in wild-type Orai1 immunoprecipitation but missing in internalization-deficient Orai1 mutants are suggested to play role in Orai1 endocytosis.
In conclusion, our results here suggest that residues 266–275 at C-terminus of Orai1 are essential for its internalization during meiosis. Using specific mutant(s) within this region, we will test the rescue of mutant(s) phenotype with potential candidates, and by quantitative proteomic analysis identify proteins associated with Orai1 and potentially important in its internalization.
-
-
-
Inhibition of Human Islet Amyloid Polypeptide Aggregation in Type 2 Diabetes by Hsp70 Molecular Chaperones
Authors: Moncef Ladjimi, Ali Chaari and David EliezerProtein misfolding, aggregation and amyloid formation play an important role in more than 30 different human diseases, including Alzheimer's, Parkinson's and type 2 diabetes (T2D). T2D is an age-dependent progressive disorder that represents 90% of all diabetes cases. Two major hormones are involved in diabetes and secreted in the β-cell pancreatic islet of Langerhans: insulin and Islet Amyloid PolyPeptide (IAPP or amylin). In comparison with insulin that has been studied thoroughly, much less is known regarding IAPP and its role in the ontogenesis of the disease. Indeed, human IAPP (hIAPP), a 37 amino acid polypeptide characterized by its C-terminal amidation and its disulfide bridge, forms fibrillar amyloids in the pancreas of patients suffering T2D, and is considered to be one of the most amyloidogenic polypeptides. Oligomers generated during the fibrillogenesis process have been linked to increased β-cell dysfunction and possible contribution to β-cell death. In fact, epidemiological studies revealed that up to 95% of patients with T2D are shown to have pancreatic hIAPP amyloid deposits, as detected in post-mortem samples. Thus, hIAPP aggregation is highly cytotoxic, plays a key role in the death of β-pancreatic cells, and correlate with the severity of the disease.
Molecular chaperones, on the other hand, are known to constitute the first line of defense against protein misfolding and aggregation. Many of the molecular chaperones are Heat Shock Proteins, or HSPs, produced in response to various stresses, including heat shock. Not surprisingly, HSPs which function by sequestering proteins in order to prevent inter-molecular interactions associated with aggregation, have specifically been shown to be beneficial in the case of amyloid diseases associated with toxic aggregation processes, and information is available regarding mechanisms by which various HSPs bind and sequester substrates. However the precise mechanisms by which molecular chaperones interact with amyloid proteins and their various intermediates specifically to prevent their toxicity and/or further aggregation, as well as the structural basis of this interaction, remain unclear.
In this work, the effect of HSP70 on hIAPP aggregation was monitored. The results show that increasing concentrations of HSP70 lead to a decrease in Thioflavine T (ThT) fluorescence indicating that the inhibitory effect of HSP70 is concentration dependent. The inhibitory effect of HSP70 is observed with concentrations as low as 1/100 relative to hIAPP and the maximum of the inhibition effect (96%) is observed with a ratio of 1/1 of [HSP70]/[hIAPP]. The length of the lag phase preceding hIAPP aggregation is increased as a function of HSP70 concentrations. These results were confirmed by Dynamic light Scattering (DLS), which indicated that the size, as determined by the Hydrodynamic Radius, RH, of the particles present at 36 h in absence of HSP70, has been reduced in the presence of different concentrations of HSP70, and low molecular weight aggregates were obtained. Thus HSP70 is clearly able to efficiently inhibit hIAPP aggregation and even suppress it at stoichiometric concentrations, as expected for a molecular chaperone having one binding site and working in absence of ATP.
These results on the inhibition of the aggregation process by HSP70 are encouraging, and may be considered as an attractive avenue for further investigation, with the long-term goal of developing inhibitors for therapeutic intervention.
-
-
-
Pristimerin Inhibits Growth and Induces Apoptosis in Human Colorectal Cancer Cells Through the Generation of Reactive Oxygen Species
Background:
Colorectal cancer (CRC) is the third most common cancer in Qatar and a major health concern for the Qatari population. Qatar has the highest rate of colon cancer compared to other countries in the eastern Mediterranean, West Asia and North Africa. Colon cancer is the most common cancer among Qatar's male population and according to the world age standard rates, around 20.8% of male Qataris have this cancer. Although progress in diagnosis and treatment has helped to extend and save the lives of many colorectal cancer patients, it still remains as one of the most prevalent human cancers. Many drugs such as 5-fluorouracil (5-FU) are being used to treat colorectal cancer, but patient(s) response to these drugs vary widely in terms of efficacy and toxicity. Moreover, it is observed that in colon cancer patients the tumor starts to develop resistance against these drugs over the course of treatment. The harmful side effects exhibited by the drugs used in cancer therapy as well as the increasing frequency of resistance to drugs have become the most challenging issues in the treatment of colorectal cancer. Hence, there exists an immediate need to discover better targeted and reliable drugs that could act as therapeutic agents which can prevent colon cancer progression and control distant metastasis as well as cure the disease with minimal side effects. Chemotherapeutic agents obtained from natural sources (plants) holds promising potential and have gained significant recognition in the field of cancer therapy. Pristimerin is a triterpenoid quinine methide present in various plant species of Cleastraceae and Hippocrateaceae families. Pristimerin has been shown to inhibit the proliferation of glioma, leukemia, myeloma, breast, lung, prostate and pancreatic cancer cell lines. Recent studies shows that pristimerin is a potent inhibitor of NF-κB. Induction of apoptosis by pristimerin was found to involve activation of caspases, mitochondrial dysfunction and inhibition of Akt signaling pathways. Pristimerin was reported to induce apoptosis in imatinib-resistant chronic myelogenous leukemia cells harboring T315I mutation by blocking NF-κB signaling and depleting Bcr-Abl.
Material and Methods
Reagents
Antibodies against Caspase 3, caspase-9, cleaved caspase-3 were purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA). Polyadenosine 5’-diphosphate ribose polymerase (PARP) antibody was purchased from Cell Signaling Technologies (Beverly, MA). BD Cytofix/Cytoperm Plus Fixation and Permeabilization Solution Kit with BD GolgiPlug, Propidium Iodide Staining Solution, Annexin V Binding Buffer, Mitochondrial Membrane Potential Detection (JC-1) Kit, Stain Buffer (FBS), Annexin V-FITC antibody, H2AX (pS139)-Alexa Fluor 647 antibody, Rabbit Anti- Active Caspase-3- BV605 antibody and PARP Cleaved Form-AF700 antibody were obtained from BD Biosciences (NJ, USA). CellROX Deep Red Reagent, MitoSOX Red Mitochondrial Superoxide Indicator, SYTOX Blue Nucleic Acid Stain and Hoechst 33342 solution were obtained from Molecular Probes, Life Technologies (CA, USA). Pristimerin, Cell Counting Kit-8 (CCK-8), DAPI, Glutathione-Reduced (GSH) and N-Acetyl-L-Cysteine (NAC) were obtained from Sigma-Aldrich (MO, USA). Human Apoptosis Antibody Array and Phospho-Kinase Antibody Array were purchased from R&D systems (MN, USA). Cell Death Detection ELISAPLUS kit was purchased from Roche Diagnostics (Mannheim, Germany).
Methods
Cell culture: Human colorectal cancer cell line HCT116 was cultured in DMEM, OXCO1 and SW48 cells were cultured in RPMI 1640 medium. Both culture medium were supplemented with 10% Heat Inactivated fetal bovine serum (FBS), 100 U/ml Penicillin and 100 U/ml Streptomycin. Cells were cultured at 37°C under a humidified 95%:5% (v/v) mixture of air and CO2.
Pristimerin was dissolved in dimethylsulfoxide as a 10 mM stock solution and stored at 4°C for the in vitro experiments. Further dilution was done in cell culture medium as required.
Cell Viability: Effect on the viability of CRC cell lines, HCT116, OXCO1 and SW48 were determined following treatment with various doses of Pristimerin for 24, 48 and 72 hours using WST-8 kit.
Apoptosis: HCT116/OXCO1 cells were treated with various doses of Pristimerin for 24 hours. After incubation, cells were harvested, washed with PBS and stained with Annexin V-FITC/PI for 20 minutes at room temperature and apoptosis was measured by flow cytometry using BD LSRFortessa analyzer (BD Biosciences, USA).
H2AX, active caspase-3 and cleaved PARP were quantified by flow cytometry. After treatment with Pristimerin, HCT116 cells were fixed and permeabilized using BD Cytofix/Cytoperm Plus Fixation and Permeabilization Solution Kit, as per protocol from the manufacturer. 0.5 × 106 cells in Stain Buffer (FBS) were stained with 3 μL each of H2AX (pS139)-Alexa Fluor 647, Rabbit Anti- Active Caspase-3- BV605 and PARP Cleaved Form-AF700 antibodies for 30 minutes at room temperature. The cells were washed with Stain Buffer (FBS) and then analyzed by flow cytometry.
Cell cycle analysis: 0.5 × 106 cells (HCT116/OXCO1) were briefly stained with Hoechst 33342 solution (10 μg/mL) and then analyzed by flow cytometry.
Mitochondrial membrane potential: 0.5 × 106 cells (HCT116/OXCO1) were briefly stained with JC-1 stain for 15 minutes at 37°C as per instructions from the kit manufacturer. The cells were washed twice with 1x assay buffer and then analyzed by flow cytometry.
ROS Production: CellROX Deep Red Oxidative Stress Reagent is a fluorogenic probe designed to reliably measure reactive oxygen species (ROS) in live cells. The signals from CellROX Deep Red Reagent is localized in the cytoplasm. The production of superoxide by mitochondria was quantitated using the MitoSOX Red reagent. It is rapidly oxidized by superoxide but not by other reactive oxygen species and reactive nitrogen species. HCT116/OXCO1 cells were treated with Pristimerin (0, 1, 2.5, 5 μM) for 24 h and finally analyzed by flow cytometry for quantification of ROS and superoxide.
HCT116 cells were preincubated with NAC (2.5 mM) or GSH (5 mM) for 30 minutes before addition of Pristimerin (5 μM) in studies to confirm the role of ROS in induction of apoptosis.
Western blot: Following treatment with various doses/combinations of Pristimerin for 24 hours, HCT116 cells were lysed with RIPA buffer and proteins were isolated. Equal amounts of protein were separated by SDS-PAGE, transferred to PVDF membranes and probed with specific antibodies. Target proteins were detected using an enhanced chemiluminescence (Bio-Rad ChemiDoc MP imaging system).
Statistics: Two-tailed Student's t tests was performed using the Origin Pro software to compare means of different treatment groups and a P value below 0.05 was considered statistically significant.
Results
The results show that Pristimerin causes a dose dependent inhibition of cell proliferation in various CRC cell lines, HCT116, OXCO1 and SW48. The inhibition of proliferation correlated with the induction of apoptosis in HCT116 and OXCO1 cell lines. Treatment with Pristimerin leads to activation of Bid, loss of mitochondrial membrane potential, as determined by JC1 staining, activation of caspase-9, subsequent activation of caspase-3 followed by polyadenosin-5’-diphosphate-ribose polymerase (PARP) cleavage and DNA double strand breaks (H2AX staining). Pristimerin was found to increase the oxidative stress in CRC cells in a dose dependent manner. Pretreatment of HCT116 cells with NAC/GSH, was found to inhibit Pristimerin mediated induction of apoptosis, confirming the role of ROS.
Conclusion
Altogether, these data confirm the role of ROS in the inhibition of cell proliferation and the induction of apoptosis in CRC cell lines by Pristimerin, and thus provide a strong rationale for pursuing the detailed mechanism of action and confirming the anti cancer activity using in vivo models and future clinical studies.
Keywords
Colorectal cancer, Pristimerin, oxidative stress, apoptosis.
-
-
-
A Circulating MicroRNA Signature for the Diagnosis of Clinically Significant Prostate Cancer
Authors: Ali H. Alhasan, Alexander W. Scott, Jia J Wu, Gang Feng, Joshua J. Meeks, C. Shad Thaxton and Chad A MirkinGold nanoparticle cores functionalized with highly oriented shells of oligonucleotides, referred to as spherical nucleic acids (SNAs), are novel three-dimensional oligonucleotide structures with unique properties that are distinct from their linear counterparts. As a result, SNAs exhibit novel biochemical activities that enable them to address many fundamental challenges associated with basic biological processes. They have been utilized to develop a number of powerful platforms for biomarker detection due to intrinsic unusual properties such as their amplifiable light scattering properties to achieve high assay sensitivity. In addition, these nanoconjugates show high binding affinities for complementary targets (reflected in elevated melting temperatures) and narrow subsequent melting transitions relative to oligonucleotide duplexes formed from conventional DNA probes of the same sequence. This behavior can be translated into significantly higher assay specificity and sensitivity to study the role of critical biomarkers in many forms of cancer, including prostate cancer (PCa).
PCa is the most common noncutaneous malignancy among men in the United States and the second most common cause of cancer mortality. Despite its prevalence, there are no specific accurate diagnostic or prognostic biomarkers. Indeed, although serum prostate specific antigen (PSA) concentration is used as a routine screening tool for prostate cancer, up to 11% of men with a PSA < 2.0 ng/ml may still have prostate cancer, and based on the serum level alone, it is not possible to distinguish between high and low risk prostate cancers. Due to the lack of specificity with PSA-based screening and harm associated with overtreatment and overdiagnosis, the United States Preventive Services Task Force has recommended that physicians do not routinely perform PSA-based prostate cancer screening. In an effort to separate diagnosis from treatment, active surveillance for men with low and very low risk prostate cancer, which combines PSA screening with rigorous scheduled prostate biopsies, has been implemented to decrease rates of overtreatment. However, active surveillance is a potential option only in a very select group of men with low grade and low volume PCa. From studies of men that meet strict pathologic criteria to begin active surveillance, nearly 70% can avoid treatment over five years. Yet, many urologists and patients are reluctant to monitor their cancer on active surveillance due to concerns for delaying treatment or potentially missing treatment during a window of cure. For aggressive PCa, some have concluded that it is undergraded at the time of diagnosis in up to 40% of prostate biopsies due to the limited accuracy of the technique. Thus, significant discrepancies between prostatic needle biopsy and radical prostatectomy (RP) specimens may be attributed to diagnostic pitfalls. Resolving such screening paradigms can be achieved by identifying novel molecular signatures capable of discriminating aggressive forms of PCa, which could lead to avoiding unnecessary biopsies, patient anxiety, or biopsy-related complications.
Detection of molecular signatures that are indicative of molecular changes related to cancer progression would provide a means for early diagnosis of PCa. MicroRNAs (miRNA, miR) are critical gene regulatory elements that are present in stable forms in serum and have emerged as potential non-invasive biomarkers for cancer diagnosis. However, advancement in analytical chemistry is required to detect low abundance miRNAs with high specificity. The research described here report the development of a novel scanometric-based miRNA profiling array, called the Scano-miR assay. This platform is highly sensitive and able to detect 1 femtomolar concentrations of miRNAs from serum and highly selective with the capability of identifying single nucleotide polymorphisms (i.e. SNPs). Indeed, it provides increased sensitivity for miRNA targets compared to molecular fluorophore-based detection systems, where 88% of the low abundance miRNA targets could not be detected under identical conditions. The application of the Scano-miR platform to high density array formats demonstrates its utility for high throughput and multiplexed miRNA profiling from various biological samples.
To assess the accuracy of the Scano-miR system, we studied the miRNA profiles of samples from men with PCa, and identified a novel molecular signature based on the differential expressions of circulating miRNA in serum samples specific to patients with clinically significant PCa. We analyzed the circulating miRNA profiles from patients with aggressive forms of PCa and compared them with those from healthy individuals and ones with indolent forms of the disease. From this study, a panel of five miRNAs PCa biomarkers has been identified as potentially useful for tracking both indolent and aggressive forms of the disease. Importantly, all patients with highly aggressive PCa in the study were the only cohort that exhibited elevated levels of an exclusively expressed miRNA in their serum samples. In addition, another miRNA biomarker was present in all samples from those with either aggressive or indolent forms of the disease but not detectable by qRT-PCR methods in samples from healthy volunteers. In addition, it is differentially expressed in patients with aggressive versus indolent forms of the disease. The other three identified miRNAs show different expression patterns, depending on the state of the disease. The signature is determined using a scoring method that calculates the aggregated levels of all five miRNAs by substracting the expression levels of down-regulated miRNAs from up-regulated ones and could be use to differentiate patients with aggressive forms of the diseases from those with indolent forms as well as healthy individuals with at least 94% and potentially 100% accuracy. This approach is important since it can be used to identify novel and low abundant miRNA targets for a wide variety of cancer diagnostic applications.
-
-
-
Point Mutation in Chloroquine Resistance-Associated Genes (Pfcrt and Pfmdr-1) in Imported Cases of Malaria in Qatar
Background
Imported malaria has been a great challenge for public health in the State of Qatar due to the large number of immigrant workers come from the Indian subcontinent and Sub-Saharan Africa. Antimalarial drug resistance has emerged as one of the greatest challenges facing malaria control today. Chloroquine (CQ) resistance in Plasmodium falciparum (Pf) is associated with genetic polymorphisms in Pf CQR-transporter (Pfcrt) and Pf multi-drug resistance (Pfmdr-1). Monitoring parasite haplotypes that predict susceptibility to major anti-malarials can guide treatment policies. CQ is used in State of Qatar mainly for treatment of uncomplicated Pf infection and incidence of CQ resistant Pf in Qatar is yet unknown. Thus, present study is conducted to determine the polymorphic regions of CQ drug resistance genes (Pfmdr1-codon86 and Pfcrt-codon76) in imported malaria cases in the State of Qatar.
Method
During September 2013 to September 2015, a total of 325 (79 Pf and 246 P. vivax) microscopically positive uncomplicated malaria samples were collected from Emergency Room, Al-Khor General Hospital and Hamad General Hospital, HMC, Qatar and confirmed by molecular assay. Nested-PCR and Restriction Fragment Length Polymorphism (RFLP) were used to detect alleles of pfcrt gene (K76T) and pfmdr1 gene (N86Y).
Result
Out of 79 uncomplicated malaria cases, the majority of patients were from East and West Africa followed by Indian Sub-continent and Central Africa. Molecular genotyping at codon 86 of the pfmdr1 gene showed that 60.7% harboured wild/susceptible allele (N86), 26.6% mutant/resistant (Y86) and 11.4% had mixed alleles (N86Y). However, the prevalence of Pfcrt mutant allele (T76), wild type (K76) and mixed alleles (T76K) was 72.1%, 22.8% and 5% respectively.
Conclusion
Molecular surveillance strategy based on imported malaria cases can be used to detect and track drug-resistant malaria. The data presented here might be helpful for enrichment of molecular surveillance of antimalarial resistance and will be useful for developing and updating antimalarial guidance for non-immune imported cases in State of Qatar.
-
-
-
Spatiotemporal Visualization of the Regional Myocardial Tissue
Authors: Ali Sheharyar, Lars Linsen, Othmane Bouhali and Teodora ChitiboiAccording to the World Health Organization (WHO), cardiovascular disease is the leading cause of deaths worldwide. The left ventricle (LV), one of the four chambers of the human heart, plays a crucial role in the performance of the entire heart. The abnormal motion of its wall muscle (myocardium) is an important indicator for multiple cardiac pathologies. Nearly, half of all heart failure cases occur due to the decline in its performance. Therefore, early detection, monitoring and accurate diagnosis of left ventricle pathologies is of critical importance. Usually, the global cardiac function parameters such as ejection fraction, and ventricular volume, etc., are used to assess the cardiac structure and functions. However, the regional abnormalities are often overlooked. The regional alterations in the heart motion are important biomarkers of several cardiac pathologies such as coronary artery disease, cardiomyopathy or hypertrophic heart disease.
The myocardium moves in a complex pattern in all three directions (radial, longitudinal, and circumferential) over the cardiac cycle. It contracts/expands (narrows/widens) and twists/untwists (clockwise/counterclockwise rotation) in short axis orientation and shortens/lengthens along the long axis direction. This complex 3D motion can be captured in a non-invasive manner using the velocity-encoded MR imaging method known as Tissue Phase Mapping (TPM). TPM offers high spatial (1–3 mm) and temporal resolution (13.8 msec) in comparison with other acquisition techniques such as tagging, tissue Doppler imaging, etc., and has proven to be a robust tool for the assessment of regional and global myocardial motion.
TPM produces spatiotemporal data that are usually visualized as a series of many static images (one for each time step). Traditionally, these static images are produced using the American Heart Association (AHA) based 17-segment model that divides the LV into 17 segments and projects them on a 2D plane perpendicular to the long axis of the heart. Also, there has been some work on the visualization of the temporal relationships but they neglect the structural or spatial information. To our knowledge, there has been no work that combines both the spatial and temporal relationships in a single representation that offers a dynamic visualization of the LV over the cardiac cycle.
In this work, we propose a novel method for the dynamic visualization of the myocardium motion over the entire heart cycle. We display both spatial and temporal relationships simultaneously for improved analysis. We propose using multiple coordinated views to show all three components (radial, longitudinal, and circumferential) of the velocity vectors in separate views (one view per component). Each component is displayed as a bulls-eye or polar plot that is color-coded with respect to its corresponding component value. The layout of the plot is such that the angular axis represents the segments of the myocardium wall, and the radial axis follows along the time dimension. The coordinated views leverage human perceptual capabilities and help in bringing out the correlations and/or disparities in the myocardial motion data. The primary objective of our work is to enhance the visual analysis to improve the understanding of the physiology and pathophysiology of the heart.
-
-
-
A Study to Explore how and where the Population of Qatar Source Health Information
Introduction
The levels of chronic disease amongst the Qatari population have increased dramatically in recent years. Whilst these diseases are highly prevalent in Qatar, awareness surrounding the recognition of symptoms and the disease itself are limited. Sourcing accurate information about health conditions is crucial. It is currently unknown how Qatari people source information concerning health problems for themselves as well as others. This information, however, is essential for our understanding so that strategies can be derived to assist the population concerning the various health problems that are encountered. We explored how and where the Qatari population seek information regarding health problems.
Methods
Ethical approval was gained from Hamad Medical Corporation/Weill Cornell Medical College in Qatar Joint Institutional Review Board (14-00017). Adult Qataris 18–85 y were approached at different sites, including educational establishments and shopping malls, and asked to complete an anonymous questionnaire to ascertain basic information concerning demographics, health status, and utilisation of health care services during the past year and sources of health information that individuals access. The data were analysed using SPSS version 23.
Results
A total of 394 questionnaires were completed, with 62% respondents being women. More men rated their health as very good compared to women (60.1% and 53.1%, respectively). However, this was not statistically significant X2(3, 387) = 5.7, p = 0.319.
Overall, more people in Qatar used the Internet as a source of health information (71.1%) than in previous studies in the USA (23.8–53.5%)(1,2). This difference between US and Qatar percentages can be explained by the fast diffusion of Internet use and overall wide spread of technology usage among Qataris (3).
More women (78.7%) than men (60.8%) used the Internet as a source of seeking information about health (X2 (1, 72) = 14.8, p
-
-
-
Real Time Investigations of Living Cancer Cells by Using Nuclear Magnetic Resonance (Nmr) Based on Planer Waveguide Nmr Detector
By Ahmad TelfahThe cell metabolism and its link to oncogenic signaling pathways have got significant interest due to their importance in cancer cell analysis, anticancer drugs development, spectroscopic micro imaging of human organs and tissues and many other biomedical applications. But the lack of advanced analytical tools for the investigation of living cell metabolism is still a challenge to be faced.
Since NMR spectroscopy is a reliable analytical method which gives comprehensive and rich chemical information about the composition of unknown materials and in the same time is a nondestructive technique and high speciation performance, it is one of the major technologies for metabolic profiling, hence allows in vitro and in vivo measurements of biological cells.
Typical NMR measurements are carried out in a cylindrical 5 mm tubes with approximately 700 μL sample, but measuring small and ultra-smaller samples volumes are not possible due to the limit of detection (LOD). Moreover, ensuring the viability and the proper living condition of cancer cell using the traditional NMR detectors is critical.
We designed and fabricated a novel miniaturized planer waveguide microslot NMR detector with on-board thermal regulator integrated with a microfluidic device. A tumour spheroid in a size of a few hundred μm diameter has been studied noninvasively and in a real time investigation mode. Moreover, the NMR spectra of cellular metabolites samples fall in the 100 pmol range were obtained with this microprobe in few minutes. Additionally, the planar geometry of the detector is suitable to the size and geometry requirements such different kind of microfluidic cellular sample holders for future studies such as bio-reactors.
In our research, we focus on metabolic analysis of production\degradation rates of living human cancer cells by using the Nuclear Magnetic Resonance (NMR) of different nuclei, which give direct evidence of the present status of the cell. A dual task cellular microfluidic NMR sample holder was designed with thermal and proper gas atmosphere controlled environment in order to maintain the viability of the studied living cells at near physiological conditions for the long-term in vitro studies and the hyphenation with adaptable lab on a chip technology.
Based on the developed NMR detector and the microfluidic chip, the dynamic processes of production and degradation of 23 cellular metabolites were monitored. Remarkably high concentrations of lactate and alanine were observed, being an indicator for a shift from oxidative to glycolytic metabolism. This distinctive development has proven to be a successful analytical tool for the elucidation of cellular functions and their corresponding biochemical pathways.
In our other investigation stream, living cancer cells is treated with metal based anti-cancer drugs (such as platinum based drugs); the metabolomics respond analyses combined with the (1H, 195Pt) NMR signals and correlation times will be employed to define the mechanism of anticancer drugs action and the molecular intra and extra cellular transport mechanism, by analysing quantities of the organic and inorganic 195Pt NMR signal beside the NMR chemical shifts.
-
-
-
Substances Secreted by Starved Human Dermal Fibroblasts Enhancing the Wound Healing Process in Rat without Scar: A Potential Acellular System for Wound Healing
Authors: Pejman Hanifi-Moghaddam and Amrollah MostafazadehBackground
Despite being a major cellular component of various engineered skin substituent, underlying mechanism of successful fibroblast transplantation in wound healing is not clear. Here we show that substances derived from starved fibroblast accelerate wound healing process in rat.
Material and methods
Starved human fibroblast cell culture supernatant (SFS) was prepared and tested for its wound healing capacity on rat skin. Twelve Wistar adult male rats were randomized into four different groups of three. On the back of each rat two wounds were created with area of 452 mm2. Each wounds were treated daily with one milliliter of SFS or cell culture medium (DMEM). The size of the wounds was measured daily until crust formation. The animals were scarified on 4th, 8th, 11th and 15th day of experiment and skin was removed for H&E and trichrome staining. Infiltration of fibroblast and inflammatory cells and collagen formation were analyzed.
Results
The diameter of the wounds treated the SFS solution was significantly decreased within the first week of treatment, compared with control wound receiving DMEM only (p
-
-
-
Simvastatin Inhibits the Function of TRPC1 and Aameliorate Endothelin 1 Induced Cardiac Hypertrophy
Authors: Senthil Selvaraj, Brij B Singh, Jassim Al Suwaidi and Magdi YacoubBackground & Purpose
Intracellular Ca2+ plays an important role in the cardiac physiology and development. Augmentation in intracellular Ca2+ activates the hypertrophic response in cardiomyocytes, although the source of the Ca2+ responsible for this is still elusive. We have previously shown that calcium influx through Transient receptor potential canonical 1 (TRPC1) channel is a key mediator of the cardiac hypertrophic response and lipid raft facilitates the channels assembly. Statins have recently been shown to exert pleiotropic protective effects in cardiac hypertrophy. Here, we studied whether simvastatin interfere with the membrane lipid raft formation and affects the TRPC1 channel function to protect the cardiomyocytes against hypertrophic stimuli.
Methods
H9C2 cells were obtained from American Type Culture Collection (ATCC, Manassas, VA) and maintained in high glucose DMEM supplemented with heat-inactivated 10% fetal bovine serum (FBS) (Gibco, MD), 100 units/ml penicillin, 100 μg/ml streptomycin in a water-saturated atmosphere of 5% CO2 at 37 °C. To induce hypertrophy, cells were exposed to endothelin 1 for 48 h. Cells treated with a combination of simvastain and endothelin-1 were exposed to simvastatin 12 h prior to the addition of endothelin-1 to the treatment medium and were then incubated in the presence of both drugs for a further 48 h. protein expression was analysed by western blotting. H9C2 cells were loaded with Fura-2 to measure the TRPC1 channel function and images were taken by using EasyratioPro (PTI Tech). For transient transfection, cells were transfected with TRPC1 siRNAs or STIM1 siRNA or scrambled control siRNA using Lipofectamine 3000. To measure NFAT luciferase activity, cells were transiently transfected with pNFAT-Luc (containing firefly luciferase gene from Photinus Pyralis; Clontech, Mountain View, CA) and 0.06 μg of pRL-TK (containing Renilla luciferase gene from Renilla reniformis, used as internal control; Promega, Madison, WI). To isolate lipid raft, cells were lysed in TNE buffer and lysates were mixed with 80% sucrose (w/v), and overlaid with 6 ml of 35% sucrose followed by 4 ml of 5% sucrose (in TNE buffer). Samples were centrifuged at 34,000 rpm for 18 h at 4 °C using SW 41 Ti Swinging Bucket Rotor. Ten 1.2-ml fractions were collected from the top of the tube and used as required.
Results
Endothelin 1 treatment induced hypertrophic response in cardiomyocytes which were confirmed by measuring cell size and hypertrophic markers, ANF and BNP (60% increase compare to control). Endothelin 1 treatment significantly induced calcium overload as revealed by an increase intracellular Ca2+ and subsequent NFAT nuclear activation compared with control. Moreover, hypertrophic stimuli increases the expression and function of TRPC1 and activate the recruitment of TRPC1 to membrane lipid raft domain from non-raft in hypertrophic cardiomyocytes (HC). Co-immunoprecipitation of STIM1, a Ca2+ sensor in the sarcoplasmic reticulum (SR), revealed that the functional interaction between STIM1 and TRPC1 was increased in HC and lipid raft domain facilitates the interaction. Silencing TRPC1 or STIM1 by respective siRNAs significantly prevented the calcium overload and NFAT activation in HC. Simvastatin treatment prevent the calcium overload and attenuates the hypertrophic response in H9C2 cells. Moreover, cholesterol depletion by simvastatin markedly reduced the calcium influx via TRPC1 by affecting the lipid raft domain and decrease the interaction of TRPC1 and STIM1 in hypertrophic cardiomyocytes.
Conclusion
Our results indicate that Ca2+ influx through TRPC1 provides a unique source of Ca2+ to activate pathologic cardiac hypertrophy and blockade of TRPC1 function by affecting the lipid raft domain formation in hypertrophic cardiomyocytes may be another important therapeutic mechanism of simvastatin in preventing cardiac hypertrophy.
-
-
-
Noninvasive Diabetes Monitoring with Electronic Nose
Authors: Amine Bermak and Muhammad HassanBackground
Diabetes is a chronic illness in which the body cannot manage the levels of sugar, and it affects an estimated 387 million people worldwide. According to World Health Organization it is the 7th leading cause of death in the world. Frequent monitoring (3 to 10 times) of blood glucose is important for diabetes patients to prevent serious health problems, but existing commercial products of blood glucose measurement often cause discomfort and pain. In these products, a lancet is used for pricking the skin to obtain a blood drop and then this blood drop is placed on the test strip for quantification of blood glucose level with a meter. This inconvenient, painful and invasive technology is the main obstacle to achieve high quality health monitoring. Providing a pain-free and noninvasive diabetes monitoring solution at an affordable cost is the major challenge to replace the existing solutions.
Objective
Based on the recent experimental findings about breath acetone as a potential correlated biomarker for changes in blood glucose, we introduce an electronic nose based breath analyzer solution for identification/ quantification of exhaled acetone and hence, blood glucose level.
Method
The experimental setup used to acquire the signatures of the acetone with the electronic nose, containing an array of four low-cost gas sensors, is shown in Fig. 1. Mass flow controllers (MFCs) are used to control the concentration of acetone in the gas chamber from 0.25 to 2.5 parts per million (ppm), which corresponds to high point for breath acetone concentration. The sensor array, placed in a gas chamber, is periodically exposed to air for 750 seconds and to acetone for 500 seconds to extract meaningful information or feature vector at each concentration in the target range. The feature vector is formed by taking the ratio (a.k.a. sensitivity) of the change in each sensor resistance during the gas exposure stage with its baseline resistance (resistance at the end of air exposure). The resultant feature vector is further used for acetone identification/quantification. For acetone identification, we form sensitivity codes by arranging their sensitivities in an ascending order and introduce hardware friendly rank-order classifier. After its identification, support vector regression is used for its quantification by utilizing feature vectors.
Results
Acetone data at 10 different concentrations in the target range of 0.25 to 2.5 ppm is acquired to evaluate the performance of our approach. Figure 2 shows the typical response of the four sensors in the array corresponding to air (from 0 to 750 seconds) and acetone (from 751 to 1250 seconds). On testing with resultant feature vectors from the experimental data, rank-order classifier identifies acetone signature with 100% accuracy, and then support vector regression (SVR) quantifies acetone with a mean square error of 0.0059. Predicted concentration with SVR against true concentration in the target range is shown in Fig. 3.
Conclusion
We have introduced a breath-based acetone monitoring solution which will not only be eagerly acceptable by the diabetes patients due to its noninvasive and pain-free nature but it will also facilitate high quality health monitoring by acquiring a large number of breath samples at an affordable cost. Test results of the proposed electronic nose system illustrate good response of the sensors to acetone induced by breadth.
-
-
-
Transcriptional Changes of Mycoplasma Contamination in Gene Expression Studies
Authors: Iman Alazwani, Marwan Abumadi, Yasmin Mohamoud and Joel MalekMycoplasma, the smallest self-replicating microorganism, is one of the most significant problems in the cell-culture field. It belongs to the class of Mollicutes, which are characterized by the absence of a cell wall, making them resistant to commonly used antibiotics, such as streptomycin and penicillin. Because of their small size, Mycoplasmas can pass through the 220-nm pores of filters used to sterilize culture media. Owing to these criteria, contaminated cell-culture with Mycoplasma not easily detected for extended periods of time, since Mycoplasma cannot be visualized by the naked eye or even by light microscopy and do not produce overt turbid growth commonly associated with bacterial and fungal contamination. The three major sources of Mycoplasma contamination in cell-culture are 1) Cross-contamination from infected cultures, 2) contaminated culture reagents (e.g. serum and trypsin), and 3) infected laboratory personnel with M. orale or M. fermentans. Knowing the importance of cell-culture as a significant research tool for a variety of biomedical disciplines, several effective methods and kits were developed to detect Mycoplasma contamination of cell-culture and others to eliminate the contamination using antibiotics.
The frequency of Mycoplasma contamination in cell-culture has been extensively discussed in the literature. Previous reports show high incidences of Mycoplasma contamination reaching up to 35% worldwide, with extreme incidences of 65% in Argentina and 80% in Japan.
Mycoplasma contamination of cell-culture has diverse and comprehensive consequences, ranging from unsafe biological products, to erroneous experimental results. Due to the lack of amino acid biosynthesis genes, Mycoplasma competes with its' host cell nutrients and biosynthetic precursors, leading to DNA, RNA and protein synthesis alterations. Using microarray platforms, numerous gene-expression studies have shown that Mycoplasma contamination significantly up regulates and down regulates thousands of genes like oncogenes, tumor suppressors, cytokines and growth factors. Therefore, in gene-expression studies, it is critical to ensure that transcriptional changes due to Mycoplasma contamination in cell-culture are eliminated and gene-expression profile is restored to normal level after anti-Mycoplasma treatment, to avoid biased results.
For this purpose, first, we developed a survey to investigate the incidence of Mycoplasma contamination in cell-cultures and the techniques frequently used for the detection and elimination of Mycoplasma in research laboratories at Qatar. Based on the output of this survey, SKOV3 ovarian carcinoma cells, LookOut® Mycoplasma PCR Detection Kit from Sigma and BM-Cyclin from Roche were selected as most commonly used cells, detection kit and elimination kit of Mycoplasma, respectively.
Second, we used RNA-seq technology, for the first time, to investigate the transcriptional changes of Mycoplasma contamination in cell-culture and the ability of anti-Mycoplasma treatment in reversing these changes.
RNA samples extracted from uncontaminated (control), Mycoplasma-contaminated and anti-Mycoplasma treated cultured cell (Skov3) were sequenced on illumine 4000 Hi-seq. Generated data were analyzed by comparing gene expression profiles of these three conditions and summarizing all differentially expressed genes and their associated pathways. Preliminary data demonstrated that mycoplasmas alter the expression of hundreds of genes in cultured Skov3 cells. A variety of pathways are affected, and both up-regulation and down-regulation were seen. Deeper analysis specifying significantly altered pathways are in progress along with analyzing data of the post anti-Mycoplasma treatment.
-
-
-
CMOS Integrated Circuits for DNA Sensing
Authors: Amine Bermak and Saqib MohamadBackground
With the advance of semiconductor technologies, bio-technological application-specific integrated circuits (ASICs) have become a major trend of the industry. Examples include Microelectrode measurement array systems for in-vitro and in-vivo physiological research at the cellular level [1] [2]. Using DNA microarrays can lead to a high throughput, which finds wide applications in genome research and drug development [3].
Objective
This paper presents a DNA detection CMOS micro-array, which can help in detection of presence of specific DNA sequences. The array is comprised of 16 × 16 sensor sites (interdigitated electrodes), each with a dedicated readout circuit, which enables fast parallel measurements. The use of CMOS processes results in much more cost effective solution as opposed to the optical systems that are currently used in DNA detection. The proposed IC also utilizes a minimal number of electrical signals, and can be easily interfaced to the outside world.
Method
Figure 1 shows the proposed sensor and readout. The single stranded DNA probe molecules can be immobilized on the sensor sites, after target molecules are added to the chip, which causes hybridization in case of a match between the receptor and probe (Fig. 2). After the addition of a suitable substrate, a RedOx reaction can be initiated on the matching sites, by the application of a suitable potential [3]. The resultant current is then fed to a Current Mode Sigma Delta ADC for digital conversion.
Typical values of the current from the redox reaction range from a few pA to the nA range, which entails the use of a high resolution ADC. Sigma Delta ADCs are capable of achieving such resolution at the expense of smaller conversion frequency. However, even a conversion time of a few seconds (which is sufficient to obtain > 15 bit resolution) should be enough in this particular case.
A typical Sigma Delta Modulator is shown in Fig. 3. The input current from the Electrode array is integrated in a current mode integrator, which is enclosed in a feedback loop. The reference current (IREF) can be generated using an on-chip bandgap reference circuit [5].
Conclusion
The use of CMOS arrays and readout circuits for biotechnological applications is a very promising field. On chip A/D conversion provides a compact alternative to bulky expensive DNA detectors. Both the array as well as the sigma delta ADC consume very low power, and the whole system can be designed to achieve sub mW power consumption.
Moreover, the integration of frontend and detection on a single substrate with minimal post-processing presents a highly cost effective solution to the optical systems widely in use. CMOS sensors can also provide higher sensitivity and reliability than their optical counterparts.
References
[1] J. Guo, J. Yuan, J. Huang, J. K. Y. Law, C.K. Yeung, and M. Chan, “29.2nV/rt Hz -59.6dB THD dual-band micro-electrode array signal acquisition IC”, IEEE J. Solid-State Circuits (JSSC), Vol. 47, pp. 1209–1220, May, 2012.
[2] J. Guo, J. Yuan, and M. Chan, “Modeling of the cell-electrode interface noise for microelectrode array measurement”, IEEE Trans. Biomedical Circuits and Systems (TBCAS), Vol. 6, pp. 605–613, Nov. 2012.
[3] Stagni, C.; et al”CMOS DNA Sensor Array With Integrated A/D Conversion Based on Label-Free Capacitance Measurement,” in Solid-State Circuits, IEEE Journal of, vol.41, no.12, pp.2956–2964, Dec. 2006.
[4] Schienle, M.; Paulus, C.; Frey, A.; Hofmann, F.; Holzapfl, B.; Schindler-Bauer, P.; Thewes, R., “A fully electronic DNA sensor with 128 positions and in-pixel A/D conversion,” in Solid-State Circuits, IEEE Journal of, vol.39, no.12, pp.2438–2445, Dec. 2004.
[5] Bo Wang; Man Kay Law; Bermak, A., “A Precision CMOS Voltage Reference Exploiting Silicon Bandgap Narrowing Effect,” in Electron Devices, IEEE Transactions on, vol.62, no.7, pp.2128–2135, July 2015
-
-
-
The Transitional Experience of Post-Diploma Nurses Returning to Study for an Undergraduate Nursing Degree in Qatar
Authors: Christine Macdonald, Carolyn Wolsey, Kathleen Benjamin and Annie ToppingThe Supreme Council of Health in Qatar aims to improve its health care system by strengthening the capabilities of its health care workforce. A university in Qatar supports this national objective by offering a 2 year Bachelor of Nursing program to post-diploma nurses. The attributes gained through baccalaureate level study, particularly clinical reasoning skills and critical analysis are important for nurses to effectively participate in health care delivery, improve patient experiences and outcomes (Aiken et. al., 2014) and advance into leadership roles.
The primary purpose of this funded study was to explore the experience of post-diploma nurses returning to Bachelor level study in Qatar. A secondary purpose was to develop the research skills and capacity of undergraduate nursing students through a collaborative research approach under the mentorship of an experienced research team from the university nursing faculty and a research active, health care industry partner. Enhancement of attitudes and beliefs toward the value of research may occur as team members work toward the common goal of completing this research. Participating in a funded research project that is relevant to nursing education and health care institutions in Qatar will undoubtedly increase mentors and student researchers personal investment and commitment to the Qatari research culture and community.
This descriptive qualitative study used a Focus Group approach to explore the experience of post-diploma nurses returning to study for a degree in nursing. A volunteer sample of 19 post-diploma nurses participated in this study.
A brief demographic survey was completed and to stimulate the participants’ thoughts related to their own personal experience about returning to school, they completed a ‘Reflective Tool’ prior to focus group participation. Five focus groups were conducted co-facilitated by student and faculty research team members. The interviews were transcribed verbatim and data were analyzed using the Framework Approach (Gale, Heath, Cameron, Rashid, & Redwood, 2013).
A collaborative approach was embedded in analysis. Initially all members read and re-read the transcripts to become familiar with the data set. One interview was initially coded reaching line-by-line agreement of the whole research team. This produced a working analytical framework with tentative codes and descriptions. These were used by analysis teams (two students and a faculty mentor) to undertake initial coding of remaining transcripts; another researcher coded one transcript independently. Any additional codes generated with descriptions were added to the analytical framework. Emergent thematic categories were used to clarify and collapse codes. Subsequently all data was charted against emergent categories to generate understanding of the post- diploma nurses’ experience. Data amenable to descriptive quantitative analysis were derived from the demographic information and reflective tool.
Preliminary findings from this study provide understanding of the motivations and challenges of post-diploma nurses returning to study. For example the significance of support from the university and sponsoring health care institution is emerging as vital to academic performance and success. The contribution of this work is the insights it offers to nurse educators working with international post-diploma nurses returning to study and organizations seeking to manage part-time study of its employees. This project will contribute to the international knowledge about this topic by adding a unique Qatar context. Dissemination of research results to the international nursing community will help raise Qatar's international research profile.
References
Aiken, L.H., Sloane, D.M., Bruyneel, L., Van den Heede, K., Griffiths, P.,… Sermeus. W. (2014). Nurse staffing and education and hospital mortality in nine European countries: a retrospective observational study. The Lancet, 1362631-8, p. 1824-1830. doi: 10.1016/S0140-6736(13)62631-8.
Gale, N., Heath, G., Cameron, E, Rashid, S., and Redwood, S. (2013). Using the framework method for the analysis of qualitative data in multi-disciplinary health research. BMC Medical Research Methodology, 13:117. doi:10.1186/1471-2288-13-117
-
-
-
Epilepsy in Qatar: Causes, Treatment and Outcome
Rationale
Epilepsy is one of the most prevalent neurologic conditions. It is estimated to affect 70 million people worldwide. Epilepsy is an important cause of disability and mortality. It is associated with social stigma and significant economic costs. Although epilepsy is a disease with a worldwide distribution, its prevalence varies between different countries. Very little is known about the epidemiology of epilepsy in Qatar. Qatar's population is a mixture of native citizens and immigrants. We aim at describing the features of epilepsy in Qatar as such information is virtually lacking from the current literature.
Methods
A database was created in 2014 to summarize information retrospectively collected on patients with epilepsy seen through the national health system (HMC) adult neurology clinic. For each subject, in addition to the typical demographic variables, we identified the age at onset, seizure types, epilepsy syndrome, etiology, treatment and outcome. Brain imaging and EEG results were also tabulated. All these variables were analyzed using the statistical package for social science (IBM-SPSS, version 20).
Results
Of 504 patients included in the database, 467 with sufficient information were analyzed. Sixty percent were men. The mean age at the last clinic visit was 35. Native Qataris represented 38.5%, Asian subjects 33%, and Middle Eastern/North African (MENA) origin accounted for 25% of the studied population. Generalized tonic-clonic seizures were the most common seizure type, noted in 89% of subjects. Epilepsy was classified as focal in 65.5% of the cases, and generalized in 23%. EEGs were abnormal in 55.5 %, showing epileptiform discharges in 49% of subjects. Imaging studies revealed epileptogenic pathologies in 40% of reports. Common causes of epilepsy were: vascular (11%), hippocampal sclerosis (8%), infectious (6%) and trauma (6%). Sixty six percent of patients were receiving a single antiepileptic drug, and 53% were seizure free at the last follow-up. Overall, the most commonly prescribed drug was Leviteracetam (41%) followed by Valproic Acid (25%) and Carbamazepine (22%). On current therapy, 54% of patients were seizure-free, 41% had a partial response and five percent were refractory. When the patients were divided by geographical background, some differences were noted. Remote infections caused the epilepsy in 15% of Asian patients (with neurocysticercosis accounting for 10%), but only in 1% of Qatari and 3% of MENA subjects (with no reported neurocysticercosis) (p
-
-
-
Histone Deacetylase Inhibitor Trichostatin A (TSA) and DNA Methyltransferase Inhibitor 5-aza-2′-deoxycitidine (5-AZA) Enhanced the Cisplatin (CDDP) Induced Cytotoxicity of Neuroblastoma Cells, in Vitro
Authors: Dietrich Busselberg, Elizabeth Varghese and Ana-Maria FloreaNeuroblastoma is a childhood cancer that is frequently treated with CDDP. Upon chemotherapeutic treatment, neuroblastoma patients might develop drug resistance. A large body of evidence associates the cytotoxic effect of CDDP in cancer cells with the formation of DNA adducts and thus interference with the DNA replication of cancer cells but also with the increase of the intracellular calcium concentration ([Ca2+]i) that leads to apoptosis. Nevertheless, it is not understood how epigenetic mechanisms, such as DNA methylation and chromatin modification might influence the effect of CDDP on cytotoxicity and [Ca2+]i of neuroblastoma cells.
Therefore, here we investigate in human neuroblastoma cell lines SH-SY5Y and IMR-32 the changes in cytotoxicity and calcium homeostasis induced by the treatment with epigenetic modulators: TSA and 5-AZA but also in combination with CDDP.
Treatment schemes for calcium homeostasis experiments were performed in four different groups: A) treatment with CDDP only (control); B) acute treatment with 5-AZA or TSA (without CDDP); C) pre-treatment with both 5-AZA and TSA (before CDDP application), D) pre-treatment with 5-AZA (before CDDP). For cytotoxicity test: the Trypan Blue Cytotoxicity test was performed using the automated cell counter ViCellXR (Beckman Coulter, Germany), for exposure times ranging 24–72 h. The concentrations used were for 5-AZA ranging 1–200 μM while for TSA 1–10 μM were used.
The results showed significant increase of neurblastoma cells cytotoxicity upon treatment, especially for the combinatory treatment 5-AZA and TSA. We observed a time and concentration dependent increased cytotoxicity. The most efficient treatment was the combination 5-AZA and TSA, showing additive effects. TSA showed higher efficiencity triggering cytotoxic effects in neuroblastoma cells than 5AZA. Furthermore, the combinatory treatment of neuroblastoma cells with epigenetic modulators and CDDP increased the efficiency of CDDP treatment in a synergistic manner, effect that could be confirmed in IMR32 cells. Thus, the combination 5-AZA/CDDP or TSA/CDDP or 5-AZA /TSA/CDDP was more effective in triggering cell death of neuroblastoma cells than each of the compound alone.
For the investigation of changes in [Ca2+]i we performed calcium imaging studies using the calcium sensitive dye Fluo-4-AM in Tyrode's buffer with calcium (1.5 mM). Fluorescent images were taken with Olympus Microscope BX51 Wi with Xenon Arc Burner and “Xcellence rt” software. CDDP (1 μM) treatment (control group) increased the [Ca2+]i (30.3% ± 11.7) group “A” in SH-SY5Y cells. This effect of CDDP was reversed by the pretreatment with 5-AZA and TSA group “C” (5.1% ± 5.1) (p
-
-
-
Clustering of Medical Images for Analysis: A Fuzzy Approach
Background and Objective
Often times, clinicians use a three-dimensional set of medical images to diagnose and plan treatments, which typically include visual identification of structures such as bones and tissues [1]. This can be a challenging task as anatomical structures of interest can contain significant noise, and easily blend with neighboring tissues. We propose to tackle 2 cases: (a) treatment planning of pelvic fractures where a small size ring formed by the fused bones of the ischium, ilium, and pubis attached to the sacrum contains vital structures (including major blood vessels, nerves, digestive and reproductive organs) and should be carefully delineated, and (b) liver cancer treatment where malignant tissue has to be carefully removed. The pixel intensity of tumor is similar to those of healthy tissue and proper delineation is of utmost important before proceeding to plan therapy.
To address the aforementioned challenges, in this work we present a soft-clustering technique using Enhanced Fuzzy C-Means (EFCM) along with a bilateral filter to detect the region of interest. The key feature of the proposed algorithm combines domain and range filtering allowing the filter to maintain balance between preservation of relevant details and the degree of noise reduction. The approach allows traditional Fuzzy C-Means not only to exploit useful spatial information, but also to dynamically minimize clustering errors caused by common noise in medical images.
Methodology
A three-step workflow is used to process the medical images:
Step 1: After MR/CT images are acquired; clinician initially draws a rough outline around the region of interest (where the fracture or tumor is present) on the two-dimensional image slices. The manual input reduces the computational time to determine the desired tissue cluster by providing the region of interest instead of scanning/processing the entire image.
Step 2: In this step, a bilateral filter is used to remove noise while preserving details of the edges [2]. Linear filters, such as Gaussian, compute a weighted average of pixel values in the neighborhood. The weights decrease with distance from the neighborhood center. This works well for images where local neighboring pixels have similar values (slow spatial variation). As the noise that corrupts these neighboring pixels is mutually less correlated than the signal, the noise is averaged away while signal is preserved. However, the assumption of slow spatial variations fails at edges, which are consequently blurred by linear low-pass filtering. In this context, we use a non-linear/bilateral filter that combines both domain and range filtering. In smooth regions, the pixel values within a local neighborhood are similar to each other, and the normalized similarity function is close to one. Consequently, the bilateral filter acts essentially as a standard domain filter, averages away the weakly correlated differences between pixel values caused by noise, and preserves edge details.
Step 3: As a last step, EFCM clustering algorithm is applied to the noise-filtered image. Fuzzy C-Means clustering works by assigning membership to each data point with respect to the cluster centers [3]. A distance is computed between the cluster center and the data point. The membership of the data towards a particular cluster center varies linearly as per the distance. Closer the data to a cluster center, higher is its membership. The summation of membership of each data point across different clusters is equal to one. An objective function based on the Euclidean metric is then used to update the membership and cluster centers iteratively. However, the parameter estimation resulting from the described objective function may not be robust in a noisy environment. Therefore in this work, we develop an algorithm that uses a modified Euclidean term (described in Table I) that is robust against noise and allows meaningful clustering of compact pixels for image analysis by the clinicians (Fig. 1).
Results and Conclusion
The method proposed in this work was evaluated using two datasets: (a) CT images of pelvic fracture (two subjects) publicly available online for research purposes, on OsiriX website (http://www.osirix-viewer.com/datasets). The image acquisition details are as followed: Slice Thickness: 2 mm, Pixel Spacing: 0.29 mm × 0.29 mm, Bit-depth: 12, and Acquisition Matrix: 512 × 512. (b) CT images containing liver with tumor from five anonymized subjects, obtained from Hamad Medical Corporation, Doha, Qatar. The image acquisition details are as followed: Slice Thickness: 3 mm, Pixel Spacing: 0.32 mm × 0.32 mm, Bit-depth: 16, and Acquisition Matrix: 512 × 512.
The algorithms were implemented on MATLAB R2013a running on a workstation with 16 GB RAM and 2.8 GHz Intel processor. The average time required to perform segmentation was recorded as 8 ± 1.5 minutes. However the computational time could be further reduced, as implementation was done without optimization of the internal function calls. An initial assessment of the experimental results has shown satisfactory outcomes in both the cases to detect pelvic fracture and liver tumor (Fig. 1). The use of traditional linear filters on the datasets has failed to identify clusters with similar pixel intensity values. The use of bilateral filter with Euclidean modification proposed in this work has lead to desired soft clustering identifying the required anatomical structures in the images.
In future, we plan to optimize and validate the method extensively on different tissue-types using multiple imaging modalities.
References
[1] Vona G. et al., “Impact of cyto-morphological detection of circulating tumor cells in patients with liver cancer,” Hepatology, 39, 792–797, 2004.
[2] Sugimoto K. et al., “Compressive Bilateral Filtering,” IEEE Trans. on Image Processing, 24, 3357–3369, 2015.
[3] Havens T. C., “Fuzzy c-Means Algorithms for Very Large Data,” IEEE Trans. on Fuzzy Systems, 20, 1130–1146, 2012.
-
-
-
Date-Pathogen Pipeline: A Pipeline to Detect Pathogenic DNA in Date Palm Cultivars
Authors: Gaurav Thareja, Sweety Mathew, Lisa Sara Mathew, Yasmin Ali Mohamoud, Karsten Suhre and Joel A MalekViruses, Bacteria and Fungal pathogens have been responsible for destruction and degradation of plants worldwide. Most often, these pathogens live a symbiotic relationship with the plant, enhancing plant growth and at times as predators, causing a wide variety of diseases. Date palms are cultivated widely in the Middle Eastern region due to their multi-faceted uses and are valued most for their nutritious fruit – the date. The trees flourish in deep sandy loam soils and can also grow in salty and alkaline soils. An old Arab folk saying “Its feet in water and its head in file” aptly describe Date Palm trees. Therefore, the importance of Date Palm trees to Qatar and in broad to the region (Arabian Peninsula) cannot be undermined.
Date palm cultivation is hindered by several constraints; especially it's vulnerability to a wide range of bacterial, viral and fungi pathogens present in the environment. Outbreaks of diseases like Bayoud disease caused by Fusarium oxysporum was reported in Morocco and spread to neighboring countries Algeria and Tunisia, resulting in destruction of millions of trees since its outbreak a century ago. This outbreak impacted socio economic conditions of farmers as poor quality but disease resistant cultivars started dominating the landscape at the expense of commercial cultivars. In Qatar, localized incidences of disease in Date Palm trees have been reported. In 2003, Department of Agricultural Development reported a first instance of Neck bending disease on Date Palm trees growing alongside the road of Majlis AL-Taawin located in Doha, Qatar. Neck Bending was previously reported in Iraq. Therefore, continuous efforts are needed to scan for opportunistic environmental pathogens, which in future can lead to disease outbreaks. In this work, we present our findings of environmental pathogens detected with our new Date-Pathogen pipeline (DPP) using geographical sampling of Date Palm Trees covering all municipalities in the State of Qatar.
A total of 96 leaf samples were sequenced on HiSeq2500 using libraries prepared by Genotyping-by-Sequencing methodology. We identified 4 different variants of the virus Enterobacteria spp in 31 samples. They belonged to two municipalities, Al Wakrah and Al Rayyan region. We uncovered two different bacteria namely Propionibacterium acnes and Staphylococcus epidermidis in a total of 52 samples growing in the Al Rayyan Municipality region in Qatar. Eight different variants of Propionibacterium was found in all the samples except one. The above bacterial pathogens are causative agents to cause acnes in human skin and known to have no effects on plants. A recent study in 2014 has reported an example of inter kingdom bacterial host transfer involving human pathogen Propionibacterium acnes Zappae and grapevine plants. This could suggest that the strain of Propionobacterium acnes identified in our samples might be in future case of interkingdom transfer from human to date palm trees. Two fungal pathogens – Saccharomyces cerevisiae and Fusarium graminearium were also found in 42 samples. It has been shown that Saccharomyces cerevisiae produces plant hormone indole-3-acetic acid (IAA), which in sufficient quantity triggers fungal cells to be more infectious in host organism. This infection was found in trees from Al Wakrah and Al Raayan municipalities. Fusarium graminearium are known to cause fusarium head blight in wheat, barley and oat. Previously, other Fusarium species oxysporum have been found to cause Bayoud disease in date palm trees which have resulted in degradation of date palm trees in Morocco and Algeria. However, Fusarium graminearium is reported in Qatar for the first time in date palm trees growing at Doha, Al Khor, Al Daayen, Al Shamal and Umm Salal municipalities. The above results are preliminary analysis and will be explored further in the next few months.
-
-
-
A Web Server for Visualization and Annotation of Genetic Variants Using Genomic Data from Qatar
Authors: Gaurav Thareja, Manish Kumar, Pankaj Kumar and Karsten SuhreIn the last decade, starting from family-based association analysis and progressing to population-based association analysis have helped in understanding etiology of many rare and complex disorders. As of Nov. 2013, National Human Genome Research institute (NHGRI) Catalog of published Genome-Wide Association Studies (GWAS) contained 1,751 manually curated publications with 11,912 SNP-trait associations. Despite large number of studies reporting different loci for complex traits, the aggregate variance explained by these loci is relatively low and more efforts are needed to look for loci with larger variance. These loci with larger variance are difficult to find as they tend to be at low frequency in general population. Previously, 1000 Genome project have shown common variants ( ≥ 10) were found in all the populations, but 17 of low frequency variants (0.5–5) were seen in single ancestry group and 53 of rare variants ( < 0.5) were present In a single population. Therefore, more number of sequencing studies is required especially on understudied populations which are not part of big sequencing projects like 1000 genome project or UK10K to unearth low frequency and rare variants which aid in our understanding of missing heritability in etiology of common disorders.
The Arabian Peninsula located at cross roads between Africa and Eurasia is not well represented in global sequencing projects. This limits our understanding of human genetic diversity as these populations are recipients of constant gene flow over generations from Africa and Eurasia. The State of Qatar located on northeastern coast of the Arabian Peninsula with alarmingly high rate of obesity and diabetes among nationals has started new initiatives to understand genetic causes for these common disorders. But, to further extrapolate information from these genetic studies to molecular disease mechanisms and generating significant biomarkers for clinical settings a comprehensive data resource is required integrating existing information from informatics and experimental approaches. This central resource requires annotations about the variant, the gene, epigenetics, gene expression and protein expression. Many resources like UCSC, Ensembl and NCBI provides these annotations but with limited capabilities in analyzing large number of variants. Variant centric resources which provide capabilities for annotation of large number of variants limit themselves to a specific category of annotation like amino acid changes, associations to traits or regulatory effects. Further, these large resources and variant centric resources share a common drawback towards difficulty in retrieving population specific annotations especially for populations which are not part of global sequencing projects. The annotation data from these understudied populations get lost in wealth of data. Therefore, population specific annotation resources are needed integrating annotations from various sources which can be used to compare population specific differences. For e.g. Genome browser part of Singapore Genome Variation Project (SGVP) integrates annotations from sources like dbSNP, NHGRI GWAS catalogue, Reactome into Malay population specific linkage disequilibrium (LD) data. In this work, we present a Qatar specific webserver for visualization and annotation of genetic variants implicated in association studies conducted in Qatari population. The webserver seamlessly integrates genomic annotations obtained from public databases with Qatar specific pre-computed genomic characteristics like Linkage Disequilibrium (LD), Recombination Rates and Allele Frequencies using already published genomic data from Qatar. It also provides user-friendly starting points for annotating single and list of genetic variants, LD blocks or genetic regions of interest. In conclusion, this webserver combines various annotation sources with genomic information from Qatari population with varied uses in field of genomic research.
-
-
-
Carboxybetaine Ester Feature as a Platform for Switchable Surface Properties
Authors: Peter Kasak, Marketa Ilcikova, Tomas Bertok and Jan TkacA lot of strategies for smart approaches on surfaces were applied such as hydrogel layer, polymer brushes or self-assembly monolayers (SAM). [1] Nowadays switchable zwitterionic materials consisting of molecules with internally balanced charge between positive ammonium and negative carboxy group are promising candidates for this application. [2] They can combine antifouling properties of their zwitterion state and complexation or sticky character in their pre-zwitterionic carboxybetaine ester form. Zwitterionic forms possess antibiofouling properties due to electrostatic interaction between charged moieties, highly hydration capability and overall neutral charge in material as well as biomimetic character because zwitterions are structural similarity to biomembranes. We showed that modifications of surface by zwitterionic based self-assemble monolayer allow enhance detection limit of biosensors down to 10–15 M for analyte, [3,4] or improve electrorheological response. [5]
Carboxybetaine esters have cationic character and permit complexation with polyanionic bioabsorbents as well as character of counter ion can adjust wettability and interaction with biomolecules.
These studies will present on the utilization of pre-zwiterionic molecules: carboxybetaine based derivates formed from lipoic acid precursor in order to modify surface for construction of impedimetric lectin biosensors and for tuning wettability and interaction with DNA and other charged (bio)molecules.
Novel pre-zwitterionic carboxybetaine ester (hydrolysable and photolysable) derivates were synthetized by protocol consists of several synthetic steps and fully characterized. Subsequently, modification of a gold surface was performed by a self-assembled monolayer deposited from a solution containing prezwitterion molecules. Self-assembly monolayer, formed from derivates, was characterized by set instrumentation as atomic force microscopy, quartz crystal microbalance XPS, contact angle etc.
Hydrolysable carboxybetaine derivate was able to from complex with polycationic DNA molecules to preconcentrate and release at pH dependent manner. During course of hydrolysis carboxybetaine ester is transferred to carboxybetaine zwitterionic form to promote DNA release due to formation of carboxylate negative charge. Additionally, gradient in wettability can be observed within progress of hydrolysis and present of long perfluorinated or aliphatic types of counter ions. For example switch in wettability can be achieved only by simple and rapid couterion exchange between superhydrophilic (contact angle (CA) below 10° (to very high hydrophobilic (CA over 140°) on rough gold surface. After completed hydrolyses zwitterionic surface can be utilized as a platform for biosensor surface with nonfouling properties. Carboxylic functionality allows immobilizing sensing molecules as lectins for electrochemical impedance spectroscopy by means of EDC/NHS chemistry. This methodology provides opportunity for ultrasensitive detection up to 10–15 M of lectins which may result of a biomarker discovery on several diseases in whole media.
Moreover utilization of photolabile ester of carboxybetaine derivates allowing spatially control wettability and pattering with photomask was performed. Photolabile 2-nitrophenyl methyl ester group was introduced to pre-zwitterionic molecule and after irradiation of prepared surface with light at 365 nm was transformed from carboxybetaine ester group to zwitterionic carboxybetaine. Progress of photolysis can be observed by change of surface zeta potential, quartz crystal microbalance and contact angle measurement. This irreversible switch along with different interaction of biological species before and after photolysis will be discussed in this contribution as well.
This contribution was made possible by NPRP grant 6-381-1-078 from the Qatar National Research Fund (a member of the Qatar Foundation). The statements contained are entirely the responsibility of the authors.
References
[1] Barner, H. G.; Lutz, J.-F.; Wischerhoff, E.; Badi, N.; Laschewsky, A.; Lutz, J.-F., Smart Polymer Surfaces: Concepts and Applications in Biosciences in Bioactive Surfaces, eds. Borner, H.;Lutz, J.-F., Springer Berlin Heidelberg, 2011, 240, pp. 1–33.
[2] M. Ilcikova, J. Tkac, P. Kasak, “Switchable materials containing polyzwitterion moieties.” Polymers, accepted
[3] T. Bertok,; A. Sediva,; J. Filip,; M. Ilcikova, P. Kasak, D. Velic, E. Jane, M. Mravcová, J. Rovenský, P. Kunzo, P. Lobotka, V. Smatko, A. Vikartovska, “ Carboxybetaine interface for electrochemical glycoprofiling of antibodies isolated from human serum” Langmuir, 2015, 31, 7148–7157.
[4] T. Bertok, L. Klukova, A. Sediva, P. Kasak, V. Semak, M. Micusik, M. Omastova, L. Chovanová, M. Vlček, R. Imrich, A. Vikartovska, J. Tkáč Ultrasensitive Impedimetric Lectin Biosensors with Efficient Antifouling Properties Applied in Glycoprofiling of Human Serum Samples, Anal. Chemistry 2013, 85 (15), 7324–7332.
[5] M. Ilcikova, M. Mrlik, V. Babayan, P. Kasak, Graphene Oxide Modified by Betaine Moieties for Improvement of Electrorheological Performance, RSC Advances, 2015, 5, 57820–57827.
-
-
-
A Self-Calibrated Gas Sensing System for Breath Analysis
Authors: Feng Gao, Amine Bermak, Farid Boussaid and Yi-Kuen LeeA self-calibrated gas sensing system for breath analysis is introduced. The system is composed of an array of high sensitivity gas sensor combined with temperature, humidity and flow sensor for calibration. The system is able to diagnose common diseases and help people stop them at early stages.
1. Introduction
Breath analysis is a new method for point-of-care health monitoring and diagnosis. Compared to traditional diagnostic techniques like blood test, urine test, biopsy, endoscopy and imaging, it has at least two advantages: complete non-invasiveness and limitless repeatability. Exhaled breath contains thousands of volatile compounds that can serve as biomarkers of metabolism processes [1]. By analyzing the pattern of the exhaled compounds, various diseases, including airway inflammation, renal failure and lung cancer, can be detected at early stages [1].
Gas chromatography (GC), mass spectrometry (MS) or the combination of the two (GC-MS) are the most frequently adopted methods in breath analysis given their high reliability and sensitivity. Nevertheless, these techniques require bulky equipment not suitable for point-of-care application. Gas sensor array based electronic nose (eNose) is a promising alternative to GC and MS. It has the advantage of portability and low cost which makes it suitable for home-based healthcare solutions. However, the response of gas sensor array also varies with different temperature, humidity and flow rate. To address this problem, in-system calibration techniques needs to be adopted.
2. Implementation
2.1 Diagram of Self-calibrated Gas Sensing System
As shown in Fig. 1, the proposed gas sensing system is composed of three major parts, which are the multi-sensor stage, the analog front end (AFE) and the digital processing unit. The sensor part includes a gas sensor array and three other sensors for calibration, which are flow, temperature and humidity sensor, respectively. The AFE part consists of two individual blocks. One is the frequency shift detection circuit for Film Bulk Acoustic Resonator (FBAR) gas sensor array and the other is a voltage detection circuit shared by the flow, temperature and humidity sensors. The digital processing unit takes charge of the sensor data sampling, processing and transmission.
Figure 1: Diagram of Self-calibrated Gas Sensing System
2.2 FBAR Gas Sensor Array and AFE
2.2.1 FBAR Gas Sensor Array
The gas sensor array is the core of the system and directly determines the overall performance of the eNose. Here, FBAR gas sensor is chosen as the element of the array to achieve high sensitivity. The selectivity of the FBAR-based sensor is drastically affected by the sensing material. By depositing different sensing materials or changing the properties of the sensing material on each individual sensor in the array, a unique pattern response to a specific gas mixtures can be generated by the array. The gas composition and concentration of the mixture can be acquired from the sensor array. For breath analysis, a set of specific sensing materials targeted at sensing biomarkers of common diseases are selected. For example, palladium is sensitive to hydrogen which is related to indigestion [1].
2.2.2 Analog Front End of FBAR
The response of FBAR gas sensor is illustrated in a frequency shift caused by mass loading effect when exposed to target gases. Two different methods can be used to detect the output signal. One is to count the high frequency signal directly with a proper ratio pre-scaling. The other method is to count the intermediate frequency (IF) signal after moving the original signal to the IF band. Because the design targets at mobile application, power consumption of the system should be one of the major considerations when designing the system. As direct counting at high frequency consumes a great deal of power, the second scheme is preferred.
Figure 3 shows a brief diagram of the frequency shift detection circuit for the FBAR gas sensor. Through RF multiplexer, each FBAR is alternatively connected to the first stage of the circuit to build an oscillator. Another reference FBAR without sensing material is used to build the reference oscillator. By mixing the sinusoidal signal of the two oscillators and low pass filtering the mixed signal, an intermediate frequency (IF) signal contains the frequency shift information of the sensor is acquired. At last, the frequency of the IF signal is read out using a simple counter.
Figure 3: Frequency shift detection circuit for FBAR gas sensor
2.3 Sensors Calibration and AFE
The response of the gas sensor array can drift due to the variation of flow rate, temperature and humidity. Calibration of the drift can be achieved by subtracting the influence of those variations. To obtain the calibration information, flow, temperature and humidity sensors need to be implemented on the same die. A BJT temperature sensor with ± 0.4 accuracy, a capacitive humidity sensor with ± 4% RH accuracy and a thermal mass flow meter was adopted. With signal conditioning interfaces, all the three sensors share the same 16 bit, 90 Hz Σ-Δ ADC.
2.4 Digital Processing Unit
The digital processing unit is designed to control the sampling rate and transmits the sensor data off-chip through a I2C transceiver. The processor also performs data fusion as multiple sensing data are obtained in the proposed system. Data processing and wireless communication are accomplished by the host controller.
3. Conclusion
A self-calibrated gas sensing system with high sensitivity and good reliability is introduced to achieve diagnosis of multiple common diseases like diabetes, airway inflammation and indigestion. The system is power efficient and small enough to be integrated in mobile devices like smart phone and tablets. The system features a self-calibration methodology through the use of multi-sensing platform namely: temperature, humidity and flow.
References
[1] De Lacy Costello, B., et al. “A review of the volatiles from the healthy human body.” J Breath Res 8 (2014): 014001.
[2] Wilson, Alphus D., and Manuela Baietto. “Advances in electronic-nose technologies developed for biomedical applications.” Sensors 11.1 (2011): 1105-1176.
[3] Benetti, M., et al. “Microbalance chemical sensor based on thin-film bulk acoustic wave resonators.” Applied Physics Letters 87.17 (2005): 173504.
-
-
-
Healthcare Workers' Perspective of Organ Donation and Transplant in Qatar – A Qualitative Study
Authors: Tulika Mehta Agarwal, Hassan Al Thani, Yousuf Al Maslamani, Rajvir Singh and Ayman ElmenyarIntroduction
Organ donation and transplant is still an evolving field in Qatar. In Qatar, a qualitative study to understand the perspective of the healthcare workers, towards barriers, promoters and system level challenges in organ donation and transplant was lacking. Hence, very limited literature is available on these issues as are experienced by healthcare workers actually involved in the various stages of this process.
Objectives
The objective of the present study was to conduct a qualitative study using phenomenological approach, with the help of focus group discussions to explore (1) Transplant system level issues; and, (2) To understand why people choose to or not to register as organ donors.
Methods
Several key stakeholders in the healthcare sector were included in the discussions. Participants were healthcare professionals (a) who are involved in organ donation and transplant activities (coordinators, surgeons, physicians), and (b) healthcare professionals involved in organ donation promotion campaigns in Qatar.
An experienced moderator from the research team was employed to conduct the discussion and the trained research assistants collected the data. The audio recordings were transcribed by professional transcribers, coded using NVivo software, analyzed in the light of Theory of Planned Behavior and researches in the similar field, and peer reviewed to derive a conclusion.
Results
The study was able to uncover several gaps in the system that are impacting the consent process and leading to under-utilization and wastage of available organs. Some key system level issues identified during the discussions were communication gap between transplant committee and some of the departments doing transplants, absence of multidisciplinary teams for organ assessment and participating through various stages of transplant process, difficulties arising because of lack of centralized centers for organ donation and transplant where all formalities could be carried out from start till the end and training deficiency reported by campaign volunteers as well as coordinators besides others. Besides this, the study was able to enlist the difficulties faced by the healthcare workers working in field of donor registrations and transplant. The study also brought out volunteers' views based on their direct interaction with public, on why people choose to or not to register during the organ donation campaigns in Qatar. Finally, the study identified some concerns in the process of organ donation and transplant where formulating new policies and protocols or amending existing ones, could affect the efficiency positively.
Conclusion
The study concludes that most challenges in organ donation and transplant in Qatar can be dealt with by focusing on creating awareness and educating people about the various issues related to organ donation through continuous campaigns and extensive media coverage of the issue. Consents, which are the core issue behind the gap between brain death cases culminating into donors, can be improved by ensuring early communication about donation decision by the donor to his/her family. Also, under-utilization and wastage could be reduced by transplant committee representation from relevant departments involved in transplants, and having multidisciplinary teams to assess the deceased donors' organs and work through the entire transplant process. This study can be referred to for further policy making in the area of organ donation and transplant in Qatar and modifying certain aspects of campaigns to make them more effective.
-
-
-
The Role of circRNA on EMT Induced Ovarian Cancer Cells
More LessCircular RNA (circRNA) represent a large class of noncoding RNAs that were previously considered as possible artifacts of abnormal RNA splicing, however, recent studies has shown that circRNA play an important role in regulating gene expression in mammals. Unlike linear RNAs, the downstream 5’ (splice donor) and upstream 3’ (splice acceptor) join together to form a closed continuous loop and this is one of the ways circRNA are formed. These exons are referred to as scrambled exons or shuffled exons and the process is known as backsplicing. circRNA can also be formed from lariat introns which escape debranching. Epithelial - mesenchymal transition (EMT) is a reversible process in which cells loses their epithelial phenotype and obtain mesenchymal phenotype. Moreover, EMT decreases expression of epithelial marker genes such as E-cadherin and increases expression of mesenchymal marker genes such as Mucin, N-cadherin, MMP2, Snail, Twist, VIM, FN, ITGA, FOX, TGFβ. Thus, EMT can play a major role in facilitating the migration, invasion and progression of cancerous cells in human body tissue. Several studies showed the regulatory role of linear forms of RNA transcripts (mRNA) on EMT, this study aims to highlight the regulatory role of circRNA in EMT.
Two epithelial ovarian cancer cell lines (CaOV3 and SKOV3) were treated with EMT inducing media supplement. RNA was isolated using all prep DNA/RNA kit. iScript cDNA synthesis kit was used for cDNA synthesis and reverse transcription. SYBR select master mix kit was used for PCR amplification. Product size was checked on 2.2% agarose gel (flash gel DNA cassettes-Lonza). CircRNAs with clear prominent bands were selected for gene expression analysis using eleven EMT signature genes by real time PCR. Migration scratch assay was used to test the ability of cells to migrate when subjected to EMT inducing media. Cells were seeded in a 6 well plate, and when they reached 80% confluency, a scratch was made using 1 ml tip. EMT media was added, and cells were kept in serum free media for 12 hours interval. Distance migrated by cells was measured in both treated and untreated wells using a Zeiss microscope. Extracted RNA from treated and untreated cells with commercially available kits was prepared for Illumina paired-end sequencing. Illumina deep sequencing using HiSeq 2500 yielded an average of 30 million read pairs per library of 100 bp read length. Using an in-house developed computational pipeline we identified and characterized the circRNA expression in EMT versus non-induced cells and compared it with the linear (mRNA) expression.
Real time PCR assay with eleven EMT signature genes showed a complete epithelial to mesenchymal transition after EMT supplement media was induced in both cell ovarian cancer cell lines (CaOV3 and SKOV3). Scratch assay showed cells which were subjected to EMT media migrated to the middle of the well and almost closed the scratch gap. However, cells in untreated wells neither showed motility nor migration. RNA-sequencing data showed that a large number of candidate circRNAs and mRNAs are differentially expressed between Epithelial and Mesenchymal states and belong to well characterized EMT markers like E-cadherin, N-Cadherin, Fibronectin, Snail and Vimentin genes. We further report that compared to mRNAs, circRNAs show a stronger differential expression trend for EMT related biochemical pathways like tight junctions,gap junctions and adherens junctions indicating a regulatory role for circRNAs in Epithelial to Mesenchymal transition.
In conclusion, our results clearly demonstrates the potential role circRNA has on EMT induced cancer cells. In future, further analysis will be done to investigate the regulatory potential of the circRNA forms by using knockdown based assay.
-
-
-
Deconstructing Olfaction with Transcriptomics: From Whole Tissue to Single-Cells, and from Zebrafish to Humans
Mammals can perceive myriad odorous molecules based on their perceived smell. It is estimated that humans can discriminate ∼10,000–1 trillion different odours. In animals, the olfactory system can also detect specific odorants that can elicit changes in behaviour and/or physiology. Thus, from identifying kin, food sources and sexually receptive mates to avoiding predation and disease, appropriate perception of environmental olfactory sensory cues is critical for survival and reproduction. The importance of sensing the molecular environment is reflected in the genetic investment in encoding olfactory receptors (ORs), which constitute the largest gene family in mammals. The OR gene repertoire is largely species-specific, and is shaped by the nature and necessity of chemosensory information for survival in each species' niche. As well as receptor differences, the morphology, size, neural projections and organization of chemosensory epithelia vary remarkably across mammals, suggesting differences in wider gene expression networks.
Odorant reception occurs primarily in the olfactory mucosa (OM), and is mediated by the ORs located in the cilia of olfactory sensory neurons (OSNs). ORs are then used in a combinatorial fashion to maximize odorant detection and discrimination. OSNs expressing the same OR are dispersed within a distinct area of the OM, and their axons coalesce into a few glomeruli in the main olfactory bulb where they synapse to second-order neurons in the olfactory pathway. It turn these neurons transmit signals to the olfactory cortex and other regions of the brain. Thus, a population of OSNs expressing a given OR constitutes an elementary unit of olfactory sensory input to the brain. However, twenty-four years after the initial discovery of the ORs, the molecular heterogeneity of the olfactory system at the intra- and inter-specific level still remains largely unknown. Our recent studies aimed to answer these questions.
Firstly, to identify single neuron-specific molecular barcodes, and to understand how the molecular heterogeneity at the single OSN level contributes to odor perception, we combined RNAseq with Fluorescent Assisted Cell Sorting (FACS) in a hierarchical fashion – from the whole tissue to single cells. Our analysis allowed us to identify hundreds of OSN-specific genes and thousands of other cell type specific genes in the OM. We were able to identify a previously uncharacterized sub-division of mature OSNs, which differentially express hundreds of genes. By sequencing single mature OSNs, we found that OSNs are extremely homogenous at the molecular level and can be subdivided in two classes based on their OR abundance levels. Notably, one of these classes is a novel class of chemosensory neurons which lack ORs, and express a unique molecular barcode. The high-sensitivity and hierarchical nature – from whole-tissue to single-cell – of our approach has the potential to unravel more novel pathways underlying olfactory neuronal diversity and function. This method can also be extended to any other cell types in the nervous system in order to discover novel genes associated with specific circuits or functions.
Lastly, to study the natural variation of the olfactory system between species with different chemosensory niches, we performed RNA-seq of the OM of zebrafish, mouse, rat, marmoset, macaque and human. Then, to better understand the evolutionary dynamics of gene expression in the olfactory system of these species, we conducted a comparative analysis of their olfactory transcriptomes. We found that ORs are expressed across a large dynamic range in all the species analysed, and that the RNA abundances correlate positively with the number of cells expressing a single receptor. The comparative transcriptomic analysis revealed a high degree of molecular conservation from zebrafish to humans. In addition, we developed a strategy that combined phylogenetics with the transcriptional profiles of OR [and other] genes to identify which receptors and gene networks may have been selected for different niches, and to better understand the evolution of olfaction.
-
-
-
Intracellular Calcium in Development and Treatment of Neuroblastoma
Authors: Dietrich Büsselberg and Noothan Jyothi SatheeshNeuroblastoma, a type of solid malignant tumour diagnosed during infancy represents around 10% of all paediatric cancers, marking it as the second most common paediatric cancer. It is identified as a highly heterogeneous tumour that varies from persistent progression to a spontaneous progression. Development of neuroblast masses occur mostly in abdomen (65%), chest (20%), neck (5%) or pelvis (5%) and is classified to four major stages as L1 (very low), L2 (low), M (intermediate) and MS (risk) group of patients. Intracellular calcium ([Ca2+]i), the secondary messenger, plays a vital role in regulating cellular processes and hence maintaining the cellular calcium homeostasis is critical. Levels of [Ca2+]i in cancer cells is eminent as it modulates the proliferative or apoptotic pathway of the cell, bestowing the effect of anti-cancer drugs on [Ca2+]i. Here we focus on the effect of [Ca2+]i in the development and treatment of neuroblastoma. In resting cells, the concentration of [Ca2+]i ranges between 10 and 100 nM, reaching up to a 100 fold increase upon the Ca2+ entry into the cells from the extracellular space or its release from the internal Ca2+ stores (endoplasmic reticulum and mitochondria). [Ca2+]i homeostasis is maintained in the cell by a Ca2+ influx and efflux mechanism, in which the inositol-1,4,5 triphosphate receptor (InsP3R) and the ryanodine receptor (RYR) play an important role in regulating the influx mechanism. Signalling pathways involved in association to neuroblastoma includes growth factors like Epidermal Growth factor (EGF), Insulin-like Growth Factor (IGF), Nerve Growth factor (NGF), Platelet-derived Growth Factor (PDGF) and Vascular Endothelial Growth Factor (VEGF). Activation of these growth factor signalling pathways, activates a cascade of downstream signalling molecules including PI3K/AKT, ALK and FAK as intermediate kinases to MYCN, NF-KB and p53 as important transcription factors involved in the development of neuroblastoma. [Ca2+]i and PI3K/AKT pathway interactions lead to a loop of continuous activation of this cascade, while the activation of ALK and FAK leads to the activation of calmodulins and CaM dependent protein kinase kinase. Several studies confers the role of [Ca2+]i in inducing differentiation, proliferation and apoptosis in neuroblastoma. This poster explains in detail on the intracellular pathways that regulate differentiation, proliferation and apoptosis in neuroblastoma and the mechanism by which the [Ca2+]i homeostasis is maintained in the cells. Calcium-Sensing Receptor (CaSR), a G-protein coupled receptor is a vital mediator protein that sustains the cellular responses and determines the cell fate in response to the external Ca2+ concentration between 0.05-5 mM from a proliferative stage to a stage of quiescence and differentiation. CaSR activation is often associated with an up regulated expression of parathyroid hormone related peptide (PTHrP), which has a role in inducing hyperglycemia in cancer cells. It is conferred that these CaSR exerts tumour suppressor functions in neuroblastoma and is found in differentiated favourable neuroblastoma tumours. Evidences suggest that in neuroblastoma cells, common chemotherapeutic drugs like arsenic trioxide (As2O3), cisplatin (CDDP) and trimethytin chloride (TMT) that are used in treatment of cancer interferes with the [Ca2+]i homeostasis and induce apoptosis. It suggests a promising role for targeting [Ca2+]i for the development of a new drug. Thus, in a nut shell, we elucidate the intracellular mechanisms that are associated with the development of neuroblastoma with the key focus on the [Ca2+]i along with possibility of development of a new drug target in the treatment of neuroblastoma.
-
-
-
Women's Representation in Clinical Research in State of Qatar – Findings from PERCEPTIONS Study
Authors: Hiba Tohid, Sahar Agouba, Lina Ahmed, Hoda Gad, Abdi Aden, Sopna Choudhury, Odette Chagoury and Shahrad TaheriObjective
To explore the trends in clinical research participation of women living in State of Qatar.
Background
Women's participation in clinical studies has been a dilemma for the researchers worldwide as they have been ‘under represented’ in research [1]. This is particularly of concern when findings specific to females for any disease are extracted from a study that has males recruited in majority [1]. Although studies have shown increased likelihood of females to participate in research [2,3] the real question is whether their participation is enough to reflect this preference in tangible study samples? Some well recognized barriers to female participation in research include child-care, poverty and transport [4]. There are certain patriarchal cultures in which women are either not fully empowered to take decisions arbitrarily [5] or require consultation with a family member before committing to a study [6]. Literature endorses that female representation be ensured in clinical research [1]. Not much is known about patterns of female participation in clinical studies in the State of Qatar.
PERCEPTIONS Study (Perceptions about Enrollment and Recruitment in Clinical rEsearch PrevalenT In State of Qatar): PERCEPTIONS Study is an elaborate, three phased, mixed design research project. This Phase was conducted to explore the existing attitudes and behaviours prevalent in the population in Qatar. With the dynamic National Vision 2030, Qatar is set to become world leader in health care research. Diabetes, hypertension, cancer and personalized medicine are some of the projected research goals therefore it is essential to gain an insight about the thoughts, beliefs and concerns of people that this research is meant to thrive with and eventually benefit.
Methods
A survey was conducted at two large-scale public events held within the State of Qatar between December 2014 and February 2015. Residents of Qatar above or equal to 18 years of age were surveyed following a verbal consent. Those visiting/touring Qatar or under 18 years were excluded from the survey. Filled surveys were entered in Microsoft Excel and analyzed on SPSS version 23.
Results
Of the total surveyed population 37.5% (n = 51) women reported they were approached for consent. Of these 64.7% (n = 33) agreed to participate while the rest [35.3% (n = 18)] refused. All the women who were invited into a research previously were well educated with only one reporting elementary level of education. The rest had achieved secondary education and above. Only 20% (n = 10) were unemployed. They were mostly between 25–44 years of age and a slightly higher proportion had spent ten years or less in Qatar. Reasons for refusal among the females in our survey included: time constraint, fear and mistrust, lack of awareness and lack of interest. Proportion of Qatari females who participated in research was equal to Qatari men (50%, n = 4) while those who refused were thrice as much as the male respondents (n = 3). Women from other Arab or Non Arab nationalities (38.8% and 37.5% respectively) who agreed to participate formed one third of the total number of respondents in each group. They displayed similar proportions in the group that declined consent. Non-Arab females however were the least likely to refuse participation in research.
Conclusion
Women in Qatar are twice more likely to participate in a clinical study than to decline consent. They are however half as likely to enroll as compared to the men. None of the female participants in our survey reported any of the reasons demonstrated throughout existing literature for refusal to participate. In fact their reasons to decline or accept participation were similar to those reported by the male respondents. Women's participation is crucial in research. These preliminary findings mandate an in depth understanding of female recruitment trends in State of Qatar.
Women, Female, Recruitment, Clinical Research, State of Qatar
References
[1] Cooley ME, Sarna L, Brown JK, Williams RD, Chernecky C, Padilla G, et al. Challenges of recruitment and retention in multisite clinical research. Cancer Nurs 2003 Oct;26(5):376–84; quiz 385–6.
[2] Tariq S, Goddard CA, Elkum N. Barriers in participant recruitment of diverse ethnicities in the state of Kuwait. Int J Equity Health 2013 Nov 20;12:93–9276–12–93.
[3] Dunn KM, Jordan K, Lacey RJ, Shapley M, Jinks C. Patterns of consent in epidemiologic research: evidence from over 25,000 responders. Am J Epidemiol 2004 Jun 1;159(11):1087–1094.
[4] Gilliss CL, Lee KA, Gutierrez Y, Taylor D, Beyene Y, Neuhaus J, et al. Recruitment and retention of healthy minority women into community-based longitudinal research. J Womens Health Gend Based Med 2001 Jan–Feb;10(1):77–85.
[5] Daunt DJ. Ethnicity and recruitment rates in clinical research studies. Appl Nurs Res 2003 Aug;16(3):189–195.
[6] Killawi A, Khidir A, Elnashar M, Abdelrahim H, Hammoud M, Elliott H, et al. Procedures of recruiting, obtaining informed consent, and compensating research participants in Qatar: findings from a qualitative investigation. BMC Med Ethics 2014 Feb 4;15:9–6939–15–9.
-
-
-
Big Data as the Foundation of a Novel Training Platform for Biomedical Researchers in Qatar
Authors: Darawan Rinchai, Sabri Boughorbel and Damien ChaussabelBackground
Technological breakthroughs witnessed over the past decade have led to an explosive increase in molecular profiling capabilities. This has ushered a new “data-rich era” for biomedical researchers. Indeed the recent availability of vast compendia of biomedical “Big Data” offers unique opportunities to devise novel approaches to knowledge discovery. We have launched an innovative “Collective Data to Knowledge” (CD2K) platform at the Sidra Medical and Research Center, which provides a hands-on accelerated training path for young biomedical researchers. The originality of this approach stems from the fact that it does not rely on de novo generation of data but leverages instead large dataset collections available in public repositories for the discovery of novel scientific knowledge. It does however recapitulates all other steps involved on the path to transformation of data into novel biomedical knowledge, including knowledge gap assessment and prioritization, hypothesis generation and testing, and generation of reports for publication in peer reviewed journals. Furthermore, besides providing accelerated hands-on training it also potentially constitutes a highly efficient approach to the generation of intellectual capital in Qatar.
Methods
The approach that we have devised relies on a wide range of available bioinformatics tools and resources.
a) Data integration and dissemination: For data dissemination we rely on a custom web application – the gene expression browser – that is used for integration of heterogeneous data (e.g. molecular profiles, together with clinical information, sample information and results from ancillary assays) [1]. It provides user with seamless access to large and complex datasets that can be viewed in an interactive format. This tool has now been deployed at Sidra Medical and Research Center and is used to create curated themed dataset collections that will be described in peer-reviewed communications (manuscripts in preparation).
b) Knowledge gap assessment: Knowledge gaps are identified via profiling of the biomedical literature for sets of differentially expressed genes. For instance knowledge gaps may be revealed among the hundreds of genes identified via transcriptome profiling as being induced by TNF-α, a host-derived pro-inflammatory cytokine. Among those genes many will be associated in the literature with pro-inflammatory responses, but a number of them will be shown via literature profiling not to be associated with inflammation, thus constituting a knowledge gap in which lies the opportunity for discovery.
c) Hypothesis generation and In Silico validation: the identification of knowledge gaps is the first step towards generation of novel knowledge. Next we rely on tens of thousands of publically available datasets to validate and extend the initial finding, often leading to formulation of novel hypotheses that can be immediately tested by accessing other relevant datasets.
d) Information extraction: We also devised standardized approaches for extracting and structuring information. These methods are used when profiling the literature and dataset collections in view of preparing the background and result sections of the reports. This principled approach helps trainees with manuscript preparation, which often constitutes a hurdle for scientists at an early in their careers.
e) Knowledge dissemination: trainees are then encouraged to submit their work in peer-reviewed scientific journals. It is the opportunity for them to learn about this essential process that is one of the cornerstones of the scientific discovery process.
Results
Workshops carried out in Qatar and in several countries around the world have been instrumental in the development of a CD2K training curriculum. In addition, a proof of principle of the effectiveness of the CD2K platform has been established with identification in a short amount of time of new discoveries with potential for high impact.
1) CD2K Training Workshops
We have conducted hands-on training workshops this year for 6 organizations. Each workshop spanned between 1 to 3 days and involving overall more than 100 participants.
An introductory CD2K training workshop was organized at the Sidra Medical and Research Center. Training material was further developed by conducting CD2K workshops in a wide range of settings: in academic research institutes, in the United States at the Jackson Laboratory for Genomics Medicine and in Singapore at the A-star Institute; in a University in Thailand (Chulalongkorn University, Bangkok); in a research hospital in France (Hopital Europeen, Marseille); in a large pharmaceutical company in the United States (MedImmune, a subsidiary of AstraZenca, in Gaithersburg, Maryland).
These workshops were instrumental to the establishment of a robust training curriculum; consisting in the following learning objectives:
a) Collective biomedical data profiling
b) Literature profiling
c) Identification and prioritization of knowledge gaps
d) Hypothesis generation and in silico validation
e) Information extraction
f) Knowledge dissemination
2) CD2K Proof of principle
A post-doctoral research fellow has been assigned to the piloting the CD2K platform at Sidra, with the objective of identifying and prioritizing potential knowledge gaps and submitting reports for publication in peer reviewed journals within 12 months for three novel findings with high potential for translation. At the time of submission of this abstract 10 months within this pilot 2 manuscripts have been submitted with a third one being finalized. The first two articles have appeared online pre-peer review in March and September of this year in the journal “Faculty of 1000 Research”:
a) The first article reports the identification of “ADAM metallopeptidase 9” (ADAM9) as a candidate biomarker for the specific assessment of tissue damage caused by infection, independently of pathogen-driven inflammatory processes [2]. This work revealed a new potential role for ADAM9 in immunological homeostasis and pathogenesis. The abundance of ADAM9 transcripts in the blood was increased in patients with acute infection but changed very little after in vitro exposure to a wide range of pathogen-associated molecular patterns (PAMPs). Furthermore it was found to increase significantly in subjects as a result of tissue injury or tissue remodeling, in absence of infectious processes. Therefore this marker could potentially be used as a triage tool for patients presenting with symptoms of infection in the emergency room that may or may not require hospitalization
b) The second article reported the identification of blood molecular signatures that correlate with protection, or lack thereof, conferred by the RTS,S malaria vaccine [3]. This finding is important because this vaccine, which was licensed this year by European regulatory authorities, only protects about 40% of vaccinated individuals. Understanding the mechanisms that undermine the efficacy of this vaccine could lead to the development of a universally protective prophylactic modality for a disease that affects about 200 millions people and causes 500,000 deaths each year worldwide.
c) A third report that is being finalized investigates the role of Aquaporin 9 (AQP9), a water-selective membrane channel protein. This molecule is regulated during infection and appears to play a role in maintaining elevated metabolism associated with inflammatory responses. It may also inadvertently promote pathogen growth with adverse consequences in conditions such as pregnancy where elevated baseline metabolic states may contribute to enhance disease severity. Finally our observations also suggest a role for AQP9 in mediating pathogen clearance via phagocytosis.
Conclusions
The approach that we have devised recapitulates all the steps involved in the scientific discovery process, from data interpretation to knowledge dissemination. It allows screening, identification and prioritization of potential knowledge gaps, followed by in sillico validation and hypothesis generation and testing, finally resulting in preparation and publication of reports in a peer-reviewed journal. Its effectiveness as a training platform stems from the fact that it does not rely on de novo generation of data for discovery and validation. It leverages instead the vast amounts of available biomedical data, which will allow for accelerated and highly efficient hands-on training of aspiring biomedical researchers.
References
[1] Speake C, Presnell S, Domico K, Zeitner B, Bjork A, Anderson D et al. An interactive web application for the dissemination of human systems immunology data. J Transl Med. 2015;13:196. doi:10.1186/s12967-015-0541-x
[2] Rinchai D, Kewcharoenwong C, Kessler B et al. Abundance of ADAM9 transcripts increases in the blood in response to tissue damage [version 1; referees: 3 approved with reservations] F1000Research 2015, 4:89 (doi: 10.12688/f1000research.6241.1)
[3] Rinchai D, Presnell S and Chaussabel D. Blood Interferon Signatures Putatively Link Lack of Protection Conferred by the RTS,S Recombinant Malaria Vaccine to an Antigen-specific IgE Response [version 1; referees: awaiting peer review] F1000Research 2015, 4:919 (doi: 10.12688/f1000research.7093.1)
-
-
-
Targeted Next-Generation Sequencing for Molecular Diagnosis of Non-Syndromic Hearing Loss in Qatar
Background
Sequencing technologies have grown exponentially in recent years resulting in next-generation sequencing (NGS) platforms which are more efficient in terms of biochemistry, time and cost. NGS is particularly applicable to highly heterogeneous diseases such as non-syndromic hearing loss (NSHL). Currently, more than 80 genes are clinically relevant and are known to cause hearing loss in humans (Vona B et al., 2015); however, there are about 129 disease associated loci (Vona B et al., 2014).
Aims
The aim of this study is to introduce a molecular diagnostic test in Hamad Medical Corporation, Qatar, using a targeted custom made 80 gene panel on Ion Personal Genome Machine® (PGM™, Thermo Fisher Scientific, USA), in order to obtain rapid and accurate NGS results in compliance with guidelines of the College of American Pathologists (CAP) and the European Molecular Genetics Quality Network.
Methods
Whole blood samples from 91 Qatari individuals (representing 31 unrelated families) that were received by the Molecular Genetics Laboratory for molecular diagnostic purposes since February 2009 were used in this study. DNA was extracted using the Promega Maxwell® 16 Blood DNA purification kit. Libraries were prepared using the Ion AmpliSeq™ Library kit with 200bp chemistry, amplified using emulsion PCR on the Ion OneTouch™ 2 system and enriched using the Ion One Touch™ ES system. Four barcoded libraries (i.e. 4 individuals) were sequenced in parallel on the Ion™ 318 v2 chip using the Ion PGM™. Base calling, signal processing and variant calling were performed using the Torrent Suite™ software. All variants were checked with the Ion Reporter™software and Intergrative Genomics Viewer (IGV, Broad institute) and in silico analysis was done using databases such as ClinVar, dbSNP, 1000 genomes browser, Deafness Variation Database, PolyPhen, SIFT, Human Splicing Finder and MutationTaster. All variants are being confirmed using Sanger sequencing which remains as the gold standard.
Results
We have sequenced 91 affected and unaffected Qatari individuals from 31 unrelated families using the 80 gene panel on the Ion PGM™. On average, 4.1 million on target reads were generated per run with a mean depth of 270 and with mean coverage of 95% at 20X and 90% at 100X. On average about 325 variants were detected per individual. Causative variant(s) were identified based on factors such as pathogenicity or clinical relevance of the variant, minor allele frequency, coverage, quality and variant segregation within the family. The study has identified key players within the Qatari population such as TECTA, CDH23, OTOF, TMC1, TRIOBP and WFS1, with about 65% of the genes resulting in an autosomal recessive mode of inheritance and 35% being autosomal dominant. All missense mutations, including premature stop codon mutations, were covered at >100x whereas indels ranging from 2 to 78 bp were covered at >50x, in line with CAP guidelines. Furthermore, reproducibility of the results was checked by repeat sequencing of individuals at random resulting in up to 97% similarity between the runs. So far we have been able to detect causative mutation(s) in approx. 85% of the cases using the custom panel. For the remaining 15% of the families targeted resequencing and whole exome sequencing were performed in order to determine a genetic cause.
Conclusion
Identification of disease causing variants for diagnosis of heterogenic disorders such as NSHL is challenging and laborious with traditional sequencing technologies. The advent of targeted NGS in molecular diagnostics has reformed the field, providing clinically significant information in a time and cost efficient manner. Our 80-gene custom panel for NSHL on the Ion PGM™ has proved to be a powerful diagnostic tool offering accurate results which is essential for genetic counselling of patients and their family members.
-
-
-
Inferring Regional and Temporal Eating Habits from Social Media Images
Authors: Yusuf Aytar, Antonio Torralba, Mehmet Efe Akengin, Ingmar Weber, Ferda Ofli and Raji AlhammouriUnderstanding population level food consumption, which has considerable influence on population health, is a major challenge. For instance, obesity, which is particularly pressing in the Gulf region, is largely driven by changes in food consumption. Many other widespread diseases, such as diabetes, heart disease, and high blood pressure, are directly or indirectly affected by eating habits. Understanding food consumption generally involves surveys and self reporting which introduce certain biases, latency and substantial cost. Social media offers new possibilities to passively monitor and study eating behaviors, and track them in real-time across regions and time.
Predicting population level statistics (e.g. tracking seasonal epidemics like Flu) can be obtained through social media (e.g. shared tags and texts) which provides large scale, non-intrusive, and location-aware (regional) data in real time. Instagram is a hugely popular image sharing application, particularly in the Gulf region. Although users often annotate their social media posts with hashtags, a lot more information remains “hidden” in the actual image, requiring novel processing methods. Noting that “a picture is worth a thousand words”, we make use of this visual information through state-of-the-art deep learning models, particularly concentrated on food-related images.
We propose a method for tracking regional and temporal food habits though social media images. Concerning technical aspects, we have two major contributions: (a) learning visual concepts from social media images with extremely noisy labels, and (b) predicting regional statistics through visual information analysis.
The recent developments in scene and image categorization, particularly the advances in deep learning, show that with large quantities of data (i.e. big data) we can achieve great performance, approaching the level of human annotations. Here we show that even with extremely incomplete labels (i.e. only a limited set of tags exist for images taken from instagram) a robust auto-tagging system can be learned using deep convolutional neural networks, particularly with the help of millions of images. We mainly focus on food images and food related tags collected from instagram. We explored two major deep learning architectures for food label prediction: the Alexnet [1] (see Fig. 1) and VGG network[2].
We explored both training from scratch (i.e. learning the system only using instagram images), and finetuning an existing convolutional network (i.e. build upon an already trained system for object categorization using large-scale imagenet database). Although both models have very strong prediction capabilities, VGG network gives better predictions overall. Figure 1 shows some example images auto-tagged with food labels using our system.
We employ our food label predictor for tracking regional and temporal food habits. These population level statistics not only inform us on healthy eating habits but also provide us cues for predicting consequences of these behaviors such as conditions and diseases. We show that certain public health statistics (e.g. alcohol consumption) can be reliably predicted by analyzing social media images through our deep learning models.
The data collection and fusion is another major issue, particularly required for real-time analysis. We developed a system that can reliably identify all the geo-location tags (e.g. places that are used while tagging the location of the images - houses, cafes, etc.) by performing a large scale grid search using geographic tessellation models. We also developed a distributed system that can keep track of the shared images in the identified locations in real time. In depth analysis are performed over these collected images.
One of the potential outcomes of our project is a system that can visualize regional and temporal food habits which can be used as a tool for predicting the future habits and understanding main dynamics that affect the food consumption. The system can track the food habits across regions, cultures and time (e.g. daily, seasonal, yearly). For instance it will be possible to see how fast food is gaining or losing prominence compared to healthier food, and in which regions it happens more drastically. We can track Christmas dinner changes over time, or what different regions of the world ate for Christmas. We can display what type of dishes are mostly consumed in the month of Ramadan, and if food image sharing is changed during the day and the night. Many other potential applications can be build upon the proposed system.
References
[1] Krizhevsky, A., Sutskever, I., and Hinton, G. E. ImageNet classification with deep convolutional neural networks. In NIPS, pp. 1106–1114, 2012.
[2] K. Simonyan and A. Zisserman. Very deep convolutional networks for large-scale image recognition. CoRR, abs/1409.1556, 2014.
-
-
-
GATE Simulation of Philips TF PET Scanner
Authors: Maya Abi Akl, Othmane Bouhali and Yassine ToufiquePositron Emission Tomography (PET) is a noninvasive imaging technique used for the diagnosis and assessment of many diseases, particularly cancer. It relies on positron emitting radioisotopes to analyze the tissues and organs functions. A PET scanner consists of a set of detectors surrounding the patient that will detect coincident gamma annihilation photons originating from the β^+ decay of the radiopharmaceutical injected into the patient and thus creating tomographic images.
Geant4 Application for Tomography Emission (GATE) is a Monte Carlo based simulation platform developed by the OpenGATE collaboration and used in the field of medical imaging. Monte Carlo methods are useful in the field of radiation medicine because of the stochastic nature of the processes involving radiation. GATE enables the modeling of scanners based on emission tomography, in particular the PET scanner. The GATE software consists of defining the geometry of the scanner, the shielding layers, the characteristics of the crystal detector and the radioactive source, the phantom where this latter is encapsulated as well as the physics processes taking place. Then, the simulation is carried out to identify the main performance parameters of the scanner and compare them to the experimental values.
The scanner modeled in this work is the Gemini TF PET/CT (Philips Medical Systems). It is being simulated using GATE and the results of sensitivity (S), scatter fraction (SF) and spatial resolution (SR) are being studied and compared to the published measurements.
The sensitivity of the scanner represents its ability to detect coincident photons emitted from inside the Field Of View (FOV) of the scanner. It is defined as the number of counts per unit time of true coincident event for a given source strength.
The scatter fraction is a measure of the system's sensitivity to scatter. The scattering of one or both of the gamma rays due to the interaction with the surrounding tissue results in falsely located coincidence events. Therefore, it is important to determine the ratio of scattered counts to the total of scattered and true counts. This ratio is called the Scatter Fraction.
The Spatial resolution of a PET scanner represents its ability to reproduce the image of an object while clearly showing the variations in the distribution of radioactivity. It is defined as the minimum distance between two points in an image that the scanner can detect.
In order to study each one of these performance parameters, dedicated phantoms that are proposed by the National Electrical Manufacturers Association (NEMA) were used in our simulation. The NEMA protocol is widely accepted as methodology for the assessment of the performance of PET systems. The radionuclide used for each type of simulation as well as the source distribution were chosen according to NEMA standards as well.
The simulated data were analyzed using ROOT, a data statistical analysis framework written in C??. Image reconstruction follows the data processing, and tomographic images are created through traditional filtered back-projection, or through an iterative series of back and forward-projection steps.
All simulations and analyses presented in this work were carried out using the Texas A&M at Qatar High Performance Cluster (HPC). We will report on the results of the sensitivity, scatter fraction and spatial resolution of the scanner described.
-
-
-
Seasonal Variation in Respiratory Syncytial Virus Infection in a Desert Climate: A Report from Qatar
Background
Respiratory viruses have a predictable seasonality, which varies regionally. The reason for such seasonality is not well known yet, but atmospheric factors such as high humidity and temperature may assist virus survival in small particle droplets or aerosols, and on infected surfaces.
Objective
The goal of the study was to determine the seasonal variation in respiratory syncytial virus (RSV) infection in a desert climate.
Methods
A retrospective and cross sectional study was performed at Hamad Medical Corporation (HMC), the only tertiary and academic medical center in the State of Qatar. The study included infants and young children ages 0 to 24 months that were admitted to our pediatric ward with diagnosis of acute bronchiolitis from the period of January 2010 to December 2012. The following information were collected: gestational age, gender, respiratory virus real time polymerase chain reaction (RVRT-PCR) conducted on nasopharyngeal secretions, and hospital length of stay (LOS).
Results
835 infants and young children met the study criteria with mean age at diagnosis of 3.61 ± 3.56 months ranging from 0.33 to 24 months. RVRT-PCR was performed on 769 (92.0%) of the participants. RSV was positive in 352 (45.7%) children admitted with clinical bronchiolitis. In addition, no viruses were identified in 142 (18.4%), and respiratory viruses other RSV were found in 275 (35.7F%) of children. Our investigation shows that there has been a steady and periodic seasonal variation in the RSV rate over the study period. A seasonal trend for the RSV (detected by RVRT-PCR) rate was evident (Fig. 1), showing annual peaks in the months of October, November, December, and January, with a significant test for seasonality (test statistics [T] = 3.15, P = 0.009).
Conclusions
In countries with desert hot weather, bronchiolitis might affect infants and children throughout the year. Our results suggest that the combination of uninterrupted RSV seasonality can provide factual guidance for healthcare planning and application of RSV prevention scheme, such as extending the palivizumab vaccine series.
Figure 1: Sequence chart for RSV rate of infection during various months in children admitted with acute clinical bronchiolitis
-
-
-
A Novel Spatial-Domain Denoising Scheme for DoFP Polarimetric Image Sensors
Authors: Xiaojin Zhao, Xiao Wang, Xin Lu, Xiaofang Pan and Amine BermakSummary
In this paper, we present a novel spatial-domain denoising algorithm and directly apply it to the mosaicked Stokes sub-images generated by the division-of-focal-plane (DoFP) polarimetric image sensors. Compared to the previous implementations with the generated raw polarization images directly interpolated and demosaicked, the proposed method not only leads to significant noise reduction, but also effectively decreases the interpolated pixels' mean square error (MSE) after the interpolation process. In addition, regarding the sequence of the proposed denoising and interpolation, the polarization image quality and the interpolation MSE can be further improved by conducting the denoising before the interpolation, which has been validated by our intensive simulation results.
Motivation
Polarimetric image sensors enable a wide range of applications that are infeasible with traditional intensity/color image sensors, such as microscopy for tumor margin detection, 3-D shape reconstruction from a single image, material classification, and cancer diagnosis. By mimicking the mature Bayer-pattern-based color imaging, polarizers with different orientations are first scaled-down to micron level then mosaicked to have the full Stokes sub-images generated simultaneously in one single frame, namely division of focal plane (DoFP) (Fig. 1). However, this single-frame solution is at the expense of temporal noise and spatial resolution loss. As shown in Fig. 2, the temporal noise issue can be well-addressed by averaging multiple image frames of same micro-polarizer, which is not feasible in the aforesaid single-frame-based DoFP. In addition, interpolation algorithms are necessary to compensate the spatial resolution loss. In this paper, we propose a non-local-mean-based spatial-domain noise reduction scheme to denoise the DoFP polarization images and minimize the mean-square-error (MSE) caused by the interpolation process. Moreover, the exploration is extended to the sequence of the denoising and the interpolation as well.
Results
We compared the overall MSE of the two different sequences for different test polarization images, and it is indicated by the intensive simulation results that denoising before the interpolation can bring lower MSE [Fig. 3 (A)]. In addition, as shown in Fig. 3 (B), we compared the MSE of traditional single-frame solution, 4-frame-averaging and the proposed implementation with spatial-domain denoising, and it is indicated the proposed scheme can achieve an MSE reduction effect similar to 4-frame-averaging by spatial-domain denoising.
Acknowledgments
This work was supported by the National Natural Science Foundation of China (Grant No. 61504087), the Kongque Technology Innovation Foundation of Shenzhen (Grant No. KQCX20120807153227588), the Fundamental Research Foundation of Shenzhen (Grant No. JCYJ20140418095735624, and JCYJ20150324141711677).
-
-
-
An Interpolation-Based Stokes Image Reconstruction Scheme for DoFP Polarization Image Sensors
Authors: Xiaojin Zhao, Xin Lu, Xiao Wang, Xiaofang Pan and Amine BermakSummary
In this paper, we present a novel interpolation-based Stokes image reconstruction scheme for the division-of-focal-plane (DoFP) polarization image sensors. Different from the previous implementations, our proposed method first demosaics the raw image by mainstream interpolation algorithms then converts the up-sampled images to Stokes images with much richer polarization-related physical information. This not only leads to significant resolution improvement to the captured raw image, but also greatly reduces the caused pixel mean square error (MSE). Experimental data from the test images have validated the effectiveness of this proposed scheme.
Motivation
Solid-state image sensors, which are capable of extracting the incident light's polarization information in addition to intensity and color (i.e. wavelength), take great advantages in a wide range of applications [1]. By looking through a layer of patterned micrometer-scale pixelated polarizing elements, a set of mosaicked polarization raw sub-images can be generated simultaneously, namely DoFP polarization imaging. As shown in Fig. 1 (a), similar to the widely-exploited Bayer pattern of color imaging, the mosaicked polarization raw sub-images down-sample each polarization channel by 75%, leading to significant spatial resolution loss. Meanwhile, in order to make the raw sub-images physically meaningful, they are typically translated to Stokes sub-images, which correspond to first three Stokes parameters representing the unpolarized and linearly polarized components of the incident light. In the previously reported implementations, the neighboring four sub-pixels (i.e. I0, I90, I45, I135) are directly substituted to the Stokes parameters' classical expressions. As a result, a 75% down-sampled Stokes images are acquired. In order to compensate this resolution loss, we propose a new Stokes image reconstruction scheme: before the Stokes image conversion, interpolate the mosaicked polarization raw sub-images with mainstream algorithms, including linear, cubic and spline.
Results
Figure 1 (c) illustrates the proposed detailed image reconstruction flow. In addition, we have also compared our proposed method to the traditional implementation of directly applying the same interpolation algorithm to the aforesaid 75% down-sampled Stokes images [Fig. 1 (b)]. For the extracted down-sampled Stokes images in the previous implementations, even with the same interpolation algorithms applied, our proposed method still outperforms by almost 10 folds in term of Stokes parameter S2's MSE (Fig. 2), which well-balances the spatial resolution compensation and the Stokes image generation by minimizing the caused overall MSE. Figure 3 illustrates the real images with different Stokes image reconstruction schemes applied.
Acknowledgments
This work was supported by the National Natural Science Foundation of China (Grant No. 61504087), the Kongque Technology Innovation Foundation of Shenzhen (Grant No. KQCX20120807153227588), the Fundamental Research Foundation of Shenzhen (Grant No. JCYJ20140418095735624, and JCYJ20150324141711677).
Reference
[1] M. Kulkarni, V. Gruev, “Integrated spectral-polarization imaging sensor with aluminum nanowire polarization filters”, Optics Express, vol. 20, no. 21, pp. 22997–23012, 2012.
-
-
-
Human c-MYBPC3 RNA Targeted Therapy, Reversal of Hypertrophic Cardiomyopathy in the Zebrafish Model
Hypertrophic cardiomyopathy (HCM) is a serious heart disease and is defined as abnormal left ventricular (LV) wall thickening with diastolic dysfunction. HCM is an autosomal dominant monogenic disease caused by a mutation in 1 of 13 or more genes encoding protein components of sarcomere (i.e. sarcomere is the subunit for muscle tissue). The myosin binding protein C (MYBPC) encoded by mybpc3 gene, a key constituent of the thick filaments of the sarcomere (Dhandapany et al., 2009). By binding to myosin, titin, and actin, MYBPC contributes to maintaining the structural integrity of the sarcomere and regulates cardiac contractility and relaxation (Harris et al., 2002). Mutations of c-MYBPC3 gene have been demonstrated to be associated with a risk of cardiac hypertrophy and represent one of the common causes of HCM with about more than 20% frequency (Houston & Stevens, 2015). Zebrafish is a widely used animal model for the cardiac genotype – phenotype association since it allows easy genetic manipulation. We have previously identified four disease causing missense mutations of MYBPC3 domain C1 in cardiac patients: Mutation1 (Arg177His), Mutation 2 (Ala216Thr), Mutation 3 (Glu258Lys) and Mutation 4 (Ser217Gly). Previously, it was shown that mybpc3 gene mutations induced a zebrafish embryonic phenotype resembling HCM(Chen et al., 2013). We have recapitulated these mutations in the zebrafish model (Da'as et al., 2014). The efficacy of human RNA injection to zebrafish embryos for rescuing the induced hypertrophic defects was recently suggested as a novel rescue strategy for HCM (Behrens-Gawlik, Mearini, Gedicke-Hornung, Richard, & Carrier, 2014). Previously, we showed that, zebrafish specific cardiac phenotypes resembling the different human mybpc3 mutations were partially reverted upon co-injection of Human c-MYBPC3 mRNA (Da'as et al, 2015). In the current study, we induced hypertrophic condition to zebrafish embryos with morpholino injections to target exon 5 (Mutation 1, 2 and 4) and exon 6 (Mutation 3). We have also analyzed the recovery of these conditions with RNA co-injection.
Methods
Zebrafish embryos were injected with Morpholino (Genetools) targeting human cardiac MYPBC3 missense mutations. Mutation 1, 2 & 4 located within exon 5 (MO e5i5) and Mutation 3 located within exon 6 (MO e6i6).Human c-MYBPC3 was cloned into pcDNA-DEST47 vector (Life Technologies), to be used to generate wild type human c-mybpc3 mRNA using the T7 polymerase (Ambion).
RT-PCR confirmed Morpholino exon splicing. Total RNA was extracted from zebrafish embryos with Trizol Reagent and further purified with PureLink® RNA Mini Kit (Invitrogen). First-strand cDNA was synthesized from 425 ng total RNA using SuperScript® III (Invitrogen) with MYBPC3 primers flanking exon 4-8 (F: 5′ GGTCAAGCTCAGCAGCTCTC 3′, R: 5′ CTGATCCGCCGACCACCTC 3′) followed by PCR.
Zebrafish embryos were injected in groups:
Group 1: Morpholino sequences designed to target the human cardiac MYPBC3 mutations:
Mutation 1, 2 & 4: Exon 5: MO e5i5: 5′TGTTTTCCTGTGGTCAGACCTTAGT 3′
Mutation 3: Exon 6: MO e6i6: 5′GCCTATGATCTGAGTCTTACCATGT 3′
Group 2: Human wildtype c-MYBPC3 mRNA co-injected with Morpholino targeting exon 5 or exon 6
For the structural and functional analysis, zebrafish cardiac phenotype were first imaged using SteREO Zeiss LUMAR.V12 microscope and Micro-manager software. Recorded time-lapse images were then analyzed using ImageJ software. Time lapse movies of beating ventricles were recorded for 3dpf embryos at 100fps. For the structural analysis, we measured ventricular wall thickness. For this purpose, from the sequential images, still frames of ventricular end-diastole (ED) and ventricular end-systole (ES) images were extracted. At these images, endocardial and myocardial boundaries were traced. Ventricular wall thickness was calculated as average thickness between these two regions. For the functional analysis, we measured heart rate and stroke volumes. Heart rate was calculated by first measuring time duration between two sequential identical timepoints in the cardiac cycle (i.e. ED or ES). 60 divided by this duration gives heart rate. To calculate stroke volume, we first calculated ventricular volumes at ED and ES. For measuring ventricular volume, we assumed that the ventricle is a prolate spheroid and employed the following standard formula to calculate the volume: volume = 4/3 π l s2 where l is the long-axis and s the short-axis radius. Stroke volume is the differences in volumes at ED and ES.
Results
Exon5 morpholino injection induces hypertrophy by increasing myocardial thickness at both systole and diastole. Additional RNA injection does not cause a statistically significant change in wall thickness.Exon6 morpholino injection induces hypertrophy and additional RNA injection partly rescues hypertrophy severity (i.e. reduced wall thickness)
Exon 5 morpholino injection decreases heart rate and additional RNA injection does not recover that. Exon 6 morpholino injection decreases heart rate even more and RNA injection does not recover that as well.
Exon 5 morpholino injection decreases stroke volume and additional RNA injection does not recover that. Exon 6 morpholino injection decreases stroke volume even more and RNA injection does not recover that as well.
Conclusion
We successfully induced hypertrophic cardiomyopathy on zebrafish embryos by targeting mybpc3 gene through morpholino injections to exon5 and exon6 sites in the gene. Compared to exon 5 mutant, exon 6 mutant had more severe hypertrophy, with thicker ventricular walls, more drastic decreased heart rate and stroke volume. Additional RNA injection partly rescued phenotype by Exon 6 injection, by restoring myocardial thickness but not heart rate and stroke volume. Additional RNA injection did not cause any difference for Exon 5 mutants. We can conclude that, RNA rescue approach partially recovered the cardiac phenotype and function in exon 5 zebrafish morphants and wasn't enough to modify the severity of the cardiac phenotype of the exon 6) zebrafish morphants. Morpholino injection and RNA based correction strategies on zebrafish are novel ways to explore genetic causes of disease and rescue strategies.
References
Behrens-Gawlik, V., Mearini, G., Gedicke-Hornung, C., Richard, P., & Carrier, L. (2014). MYBPC3 in hypertrophic cardiomyopathy: from mutation identification to RNA-based correction. Pflügers Archiv - European Journal of Physiology, 466(2), 215–223. doi: 10.1007/s00424-013-1409-7
Chen, Y. H., Pai, C. W., Huang, S. W., Chang, S. N., Lin, L. Y., Chiang, F. T., … Tsai, C. T. (2013). Inactivation of Myosin Binding Protein C Homolog in Zebrafish as a Model for Human Cardiac Hypertrophy and Diastolic Dysfunction. Journal of the American Heart Association, 2(5). doi: 10.1161/jaha.113.000231
Da'as, S. I., Yu, J., Butcher, J. T., Krishnamoorthy, N., Al Suwaidi, J. A. S., Kassem, H., … Yacoub, M. H. (2014). Abstract 17545: Different Human Mutations in the Myosin Binding Protein C3 (MYBPC3) Produce Specific Cardiac Phenotypes in the Zebrafish. Circulation, 130(Suppl 2), A17545.
Dhandapany, P. S., Sadayappan, S., Xue, Y., Powell, G. T., Rani, D. S., Nallari, P., … Thangaraj, K. (2009). A common MYBPC3 (cardiac myosin binding protein C) variant associated with cardiomyopathies in South Asia. Nat Genet, 41(2), 187–191. doi: http://www.nature.com/ng/journal/v41/n2/suppinfo/ng.309_S1.html
Harris, S. P., Bartley, C. R., Hacker, T. A., McDonald, K. S., Douglas, P. S., Greaser, M. L., … Moss, R. L. (2002). Hypertrophic Cardiomyopathy in Cardiac Myosin Binding Protein-C Knockout Mice. Circulation research, 90(5), 594–601. doi: 10.1161/01.res.0000012222.70819.64
Houston, B. A., & Stevens, G. R. (2015). Hypertrophic Cardiomyopathy: A Review. Clinical Medicine Insights: Cardiology(4620-CMC-Hypertrophic-Cardiomyopathy:-A-Review.pdf), 53–65. doi: 10.4137/CMC.S15717
S Da'as, EA Mohamed, J Yu, J Butcher, J Al Suwaidi, M Yacoub (2015). Strategies to normalize zebrafish specific cardiac phenotypes resembling different human myosin binding protein C3 mutations using RNA approach. EUROPEAN HEART JOURNAL 36, 606–607
-
-
-
Molecular and Structural Changes in Induced-Brain Stroke Tissue Using FTIR Imaging Spectroscopy, Scanning Electron and Atomic Force Microscopy
Authors: Mohamed H Ali, Khalid A Al-Saad, Eman M Fayyed, Anton Popelka, Md F Rakib and Carmen M Ali1. Background
Stroke, i.e. loss of brain function(s) due to disturbance in the blood supply to the brain, is the main cause of adult disability (e.g. paralysis) in the world, leaving more than half of the patients dependent on daily assistance. In Qatar, stroke is a major health problem with an estimated incidence of 238/100,000 per year for the population over 45 years old [1]. Stroke patients are often hospitalized and/or subjected to intensive rehabilitation programs for long periods of time, and their quality of life is severely affected socially and economically. Around 10% of the hospital beds in Qatar are occupied by stroke patients [1]. Thus, without major advances to improve prevention, treatment and rehabilitation of stroke, the social and economic costs of this disease will increase dramatically.
There are pathological and physiological changes on the cellular and molecular levels associated with stroke. The objective of this work is to determine the molecular and structural changes occurring in the tissue of rat's brain. Vibrational spectroscopy, i.e. Fourier transform infrared (FTIR) imaging spectroscopy, was used as rapid and objective diagnostic platform to investigate the pathological and pathological changes in the rat's brain sections three weeks after stroke. FTIR spectroscopy was also used to differentiate between the biochemical makeup of the white and grey matters of a healthy control brain samples. Also, in the current study, scanning electron (SEM), energy dispersive X-ray spectroscopy (EDX), and atomic force microscopic (AFM) techniques were assessed to study the structural changes in the rat's brain tissues after experiencing an induced stroke.
2. Experimental
2.1. Sample preparation
Rats were anesthetized using 2–3% isoflurane. Experimental stroke was induced in rats by 90-min occlusion of the right middle cerebral artery with an intraluminal filament. Rats were euthanized with a lethal dose of sodium pentobarbital and transcardially perfused with 4% paraformaldehyde. Rat's brains were extracted, embedded in paraffin and then serially sliced, using semi-automated rotary microtome, into 5 μm thickness sections for the FTIR imaging and AFM analysis and 35 μm thickness for the SEM and EDX analysis. The brain sections were mounted on MirrIR CFR, Low-e microscope slides for the FTIR imaging analysis, and on aluminum metal for the SEM analysis and EDX analysis. The paraffin was removed from the samples by using xylene and isopropanol.
2.2. Instrumentation
2.2.1. FTIR Imaging Measurements
The FTIR images were obtained using FTIR spectrometer (Agilent Technology) at a reflection mode within the range of 4000–700 cm–1. Spectral images were analyzed using Metlab software (The Mathworks Inc.). Origin 2015 software was used for graph drawing. Principal component analysis (PCA) was performed to study the spectral data variations between the FTIR spectra and images.
2.2.2. Scanning Electron Microscopy (SEM)
Rat's brain sections of 35 μm thickness were mounted on aluminum slides for SEM analysis. All the samples were viewed with a FEI Quanta 200, USA scanning electron microscope at 10 kV. SEM micrographs of the brain stroke and healthy rat's sections were compared. Elemental distribution in both healthy and induced stroke brain sections were investigated by using energy dispersive X-ray spectroscopy (EDX) equipped with SEM. The spectra provided a semi-quantitative view of the elemental composition of both weight and atomic percent.
2.2.3. Atomic Force Microscopy (AFM)
Bruker atomic force microscopy (AFM) was used for imaging and quantitatively determining the local elastic properties of healthy and induced stroke rat's brain sections. A controllable and constant force was applied at each data point and using the resulting force-distant curve for the formation the AFM images. Brain sections were scanned at 10 μm by 10 μm. About 100 force-distance curve were collected for each healthy and induced stroke brain sections and two random scan lines of force-distance curves was recorded.
3. Results and Discussions
The FTIR spectroscopy results indicated that the white matter is richer in lipid content than the grey matter as shown in Figs. 1 and 2. The infrared spectrum images showed a decrease in the lipid content of the white matter associated with the induced stroke brain sections. FTIR bands assigned to the bio-chemical makeup such as proteins, lipids and ester varied in positions, line-shape, and intensity between control and induced stroke brain samples. The spectral images showed that there is a configuration changes is associated with the lipid bands in the rat's brain white matter that experienced stroke.
The FTIR spectral images of the white matter in the induced stroke brain sections indicated that amide I and ester bands experienced a bio-chemical changes as shown in Fig. 3 and 4. Figure 5 shows the second derivative of the collected FTIR spectra from induced stroke brain sections. In Fig. 5, there are spectral differences that assigned to ester and protein regions. Figure 6a represents the loading spectra of the first three principal component analysis (PC1, PC2 and PC3). The variations principally were located in the regions of amide I band at (∼1695-1637 cm–1) and small variation in the amide II band at (1543 cm–1). Figure 6b represents the loading spectra of the PC4, PC5 and PC6. The variations principally were located in the protein region, mainly amide I band at (∼1695-1637 cm–1) and ester band at about 1730 cm–1. The use of FTIR imaging and chemometric analyses such as principal component analysis (PCA) of spectral data allows to investigate and differentiate spectral images pattern collected from control and stroke rat's brain samples.
The scanning electron microscope results showed that lesion region in the induced stroke brain sections are enriched by the selected elements such as Fe and Ca as shown in Fig. 7 (a & b). Scanning electron microscope (SEM) micrographs indicated that there is structure change in the induced stroke brain section. The structure of stroked brain sample in the nanometer scale appeared to be significantly rough compared to the control brain sample (Fig. 8 a & b).
Atomic force microscope (AFM) images showed that the stroke brain section is swollen compared to healthy brain sections. The AFM images of the induced stroke brain sections appeared more stretched when compared to the control brain section image as shown in Fig. 9 (a & b). AFM results also showed that the force-distance curves in Fig. 10, recorded using control (healthy) brain sections (blue) and induced stroke brain sections (red). The force-distance showed that the AFM cantilelver deflection of the healthy brain samples is higher than the induced stroke brain section. This indicate that the healthy brain section are softer and elastic than the induced stroke brain sections.
4. Conclusion
FTIR imaging spectroscopy, scanning electron and atomic force microscopy techniques were able to analyze and differentiate between the healthy and induced stroke rat's brain sections on the molecular, structural and global levels making them valuable tools to investigate, diagnose and study the structural plasticity of the stroke induced brain. FTIR imaging spectroscopy in combination with multivariate analysis such as principal component analysis (PCA) is a non-destructive technique that proves to be rapid, accurate and straightforward to be performed. It constitutes a powerful approach to be used as a medical diagnosis tool to investigate the pathological changes associated with stroke in the brain tissues.
Keywords
Fourier Transform Infrared (FTIR) imaging spectroscopy, Scanning Electron Microscopy (SEM), Atomic Force Microscopy (AFM), Brain tissue, Stroke, Chemometric Analysis
Acknowledgments
This article was made possible by a NPRP award [5 - 381 - 3 - 10] from the Qatar National Research Fund (a member of The Qatar Foundation). The statements made herein are solely the responsibility of the authors. We would like to acknowledge the Center for Advanced Materials at Qatar University for performing the AFM analysis, and Central Laboratories Unit at Qatar University for performing the SEM and EDX analysis.
Reference
[1] Hamad, A., Sokrab, T.E., Momeni, S., Mesraoua, B., and Lingren, A., Stroke in Qatar: a one-year, hospital-based study. J Stroke Cerebrovasc Dis, 2001. 10(5): p. 236–41.
-
-
-
Static and Dynamic Retinal Vessel Analyses in Patients with Stroke as Compared to Healthy Control Subjects
Authors: Nandu Goswami, Stefan Palkovits, Laura Pertl, Markus Kneihsl, Patrick Deboever, Franz Fazekas and Martin WegerBackground
Several risk factors for developing stroke have been described previously and the vast majority concerns the vascular system and its adjacent organs. The microcirculatory bed of the retina shares similar anatomical and physiological characteristics with the cerebral and coronary circulations. Therefore, structural changes in the retinal blood vessels can mirror cardio- and cerebrovascular events. In addition, dynamic response of vessel width during a stimulation with diffuse flicker light can be evaluated. In healthy subjects this stimulation leads to a vasodilation of retinal vessels, a phenomenon called neurovascular coupling. It has been shown that vascular pathologies like diabetes can reduce this flicker light evoked response.
The aim of the present study was to further substantiate the relevance of retinal analysis in stroke research. Retinal arterial and venous diameters were investigated in stroke patients and compared to the findings with healthy, age-matched control subjects. Effects of flicker light stimulation were compared between both groups.
Methods
18 patients suffering from recent stroke and 16 age-matched control subjects were included in the present study. In each subject review of current medication and medical history as well as physical and neurological examinations were performed. Static and dynamic vessel analyses were performed using the Retinal Vessel Analyser (RVA). RVA is a device for the evaluation of the retinal vascular system that allows precise measuring of the diameters of retinal arterioles and venules. In static vessel analysis diameter of all vessels entering the optic disc were evaluated. Central retinal artery equivalent (CRAE), central retinal vein equivalent (CRVE) and arterio-venous ratio (AVR) were calculated. In the dynamic analysis, a retinal arteriole and a retinal venule were examined before and after flicker light stimulation for 60 seconds. Flicker response, the relative change of vessel diameter due to flicker light stimulation, was calculated.
Results
CRAE was significant smaller in stroke patients as compared to the control group, whereas CRVE was comparable between the groups. AVR, therefore, was also significantly smaller in the stroke group. Dynamic vessel analysis also found reduced arteriolar diameters in stroke patients. Even though response to flicker light was smaller in stroke patients this difference did not reach level of significance. A moderate negative correlation could be shown for CRAE and the mean arterial pressure, as the latter was elevated in the patients group. No association could be found between CRVE and mean arterial pressure.
Conclusion
Patients who developed stroke show smaller retinal arterial diameters and tend to have a reduced flicker response. This decline in arterial diameter is probably explained by the more prevalent vascular risk factors like hypertension in this group of patients. The role of reduced retinal flicker response as a risk factor for stroke needs to be addressed in further studies. The data of our study is in good agreement with previous published data showing that smaller retinal arterial diameter is associated with an increased risk for developing stroke. Our study indicates that retinal analysis is a non-invasive and convenient tool that is relevant to study microvascular changes in stroke patients and at-risk individuals. This is of high relevance in Qatar's population due to the high prevalence of many risk factors – including diabetes, smoking, obesity, high cholesterol, hypertension and inactivity.
-
-
-
Thymidylate Kinases as Potential Anti-Cancer and Antibiotic Drug Targets
By Gordon RuleThymidylate kinases (TMKs) play a central role in the production of nucleotide precursors that are required for the replication of DNA. Consequently, this enzyme is a potential drug target for the discovery of anti-bacterial, anti-fungal, and anti-parasitic drugs. In addition, TMKs are also involved in the activation of prodrugs. In particular, the anti-HIV drug AZT is activated by human TMK (huTMK) and the low efficiency of huTMK towards AZT is a significant problem in the use of AZT in the treatment of HIV. Finally, nucleotide precursors are required in large amounts by cancerous cells, thus the inhibition of huTMK by chemotherapeutic agents may enhanced the arsenal of drugs that are used to treat cancer.
Although there has been some effort to develop inhibitors of TMKs, these efforts have been hampered by the difficulty in performing high throughput screening using compound libraries. In addition, the characterization of TMK-drug complexes has been limited to X-ray diffraction studies which provide static information about the enzyme-drug complex. There have been no attempts to apply high-resolution multi-nuclear NMR techniques to determine the fundamental dynamic properties of these enzymes and how the structure and dynamics of the enzyme are altered by the binding of substrates or inhibitors.
As a preliminary step in characterizing these enzymes by NMR we have over-expressed TMKs from yeast, human, and two pathogens - Plasmodium falciparum and Candida albicans. Expression of these TMKs was optimized by the design of synthetic genes for expression in bacteria. In the case of the human enzyme, we are able to routinely produce 250 mg of the enzyme/L of culture. Preliminary NMR spectra of the yeast, human, and plasmodium enzyme show that the protein is a homo-dimer in solution, as anticipated from X-ray studies. The amide and methyl spectra are well resolved, indicating that resonance assignment by traditional TROSY based methods will be feasible for both the amides and the methyl resonances. In particular the high sensitivity and dispersion of the methyl spectra will facilitate characterization of the dynamic properties of these enzymes by carbon and deuterium relaxation. Ligand induced changes in the dynamics and structure of huTMK in solution will be characterized using NMR methods. These studies will provide additional insights into the inability to huTMK to effectively activate AZT. The entropic component of the thermodynamics of substrate binding to TMK from the parasite that causes malaria will also be characterized by determining dynamic changes by NMR methods.
The development of NMR methods to study these enzymes also provides a method for high throughput screening of compound libraries by detecting chemical shift changes in the NMR spectral of the enzyme due to binding of a potential lead compound.
-
-
-
Analysis of Advanced AQ System – Z1® for Sustainable Food Supply in Qatar
More LessThis paper presents a new generation of sustainable, secured, multifunctional and self-supported Aquaponics Greenhouse System, vegetable and fish production with limited use of land, environmentally friendly and water & energy & natural resources high efficiency system. AQ System – Z1® is based on high advanced Green technologies and methodologies, and tightly related to the Qatar comprehensive National Progress AQ System – Z1® is specially designed for Qatar demographic and climate conditions, regarding National Strategic Grand Challenge Pillars: 1Water Security and Water Sustainability & 2Energy Security and Energy Sustainability & 3Food Security and Food Supply, throughout the year. It is an environmentally friendly and water & energy & natural resources high efficiency system with new agricultural approaches. AQ System – Z1® uses ∼92–95% less water than traditional and modern agricultural and fishery methods. Farming is based on new approaches of the water independent & recycling system, on the high sensitivity & efficient technology, which creates “Stabilized water”. The new-formed state of water, the sub-atomic oriented structure, have higher levels of energy, which scientifically transfers to the growth cells of vegetables and fish, boosts their Genome and Growth Hormones, promotes rapid growth of the plants and the fishes for the time period, bringing yield several times higher compared the conventional and modern agriculture and fishery, and without any genetic harnesses. The energy efficiency of the AQ System – Z1® is achieved by using renewable energy operating systems such as solar panels, windmills, geothermal system and underground heating & cooling systems, thus following Qatar's national security strategy in implementing economical alternates and renewable low carbon energy technologies. AQ System – Z1® is based on Green, sustainable technologies for smart, intelligent buildings, with the highest processing and operational standards, natural, recycled building materials, combination of sustainable vertical & horizontal farming, multiple space efficient cultivation and Greenhouse Gas emission reduction. AQ System – Z1® does not require the use of pesticides, steroids or fertilizers, antibiotics, GMO seeds and feed and avoids generation of environmental pollutants. AQ System® is software driven technology of the advanced Greenhouse farming. The AQ System – Z1® exhibits no points of failure, and as such can operate continuous hours throughout the year and continue producing forever. AQ System – Z1® offers high economically and profitable production of vegetables and fish, with both great taste and high nutritional values.
-
-
-
Inhibition of p90 Ribosomal S6 Kinase Attenuates Cell Migration and Proliferation of the Human Lung Adenocarcinoma through Phospho-GSK-3b and Osteopontin
Background
Lung cancer is the second most common cancer in both men and women and it is the leading cause of cancer deaths worldwide. Lung cancer can be divided into two broad categories: non-small cell lung cancer (NSCLC), which consists of about 85% of all lung cancers and small cell lung cancer (SCLC), which account for 15% of all lung cancers. The evolution of lung cancer is a multistep process involving genetic and epigenetic alterations. Standard treatment therapies such as radiation therapy, chemotherapy and surgery has reached a plateau phase. As a result, much work has centered on identifying the molecular targets involved in the tumor cell proliferation, survival and metastasis in effort to identify novel therapeutic approaches. p90 ribosomal S6 kinase (p90RSK) constitutes a family of serine/threonine kinases that have been shown to be involved in cell proliferation of various malignancies via direct or indirect effects on the cell-cycle machinery.
Objectives
To investigate the role of p90RSK in lung adenocarcinomas and whether the inhibition of p90RSK diminishes cancer progression. Moreover, we investigated the involvement of glycogen synthase kinase-3β (GSK-3β) and osteopontin (OPN) in the p90 RSK induced lung adenocarcinoma progression.
Methods
p90RSK, OPN, GSK-3β protein expression were examined in the A549 human lung adenocarcinoma cell line in the presence and absence of BI-D1870 (BID), a p90RSK inhibitor. Gene expression of anti-apoptotic and pro-apoptotic markers namely Bcl2 and Bax, respectively, were studied by reverse transcription polymerase chain reaction. In addition, the A549 lung adenocarcinoma cell line was characterized for cell proliferation using the MTT assay and cell migration using the scratch migration assay.
Results
Our study revealed that the treatment of the A549 lung adenocarcinoma cell line with BID resulted in a significant reduction in protein expression of p90RSK 1 (69.32 ± 12.41% of control; P < 0.05). The inhibition of p90RSK also showed a significant suppression of cell proliferation (54.3 ± 6.73% of control; P
-
-
-
Monitoring Quality of Life in Child, Teenage & Young Adult (CTYA) Cancer Care
Authors: Jon Perkins, A Al Saied, Hisham Morsi, Holly Clark, Azza Hassan and Elias AlemayehuCancer patient survival has steadily increased following treatment over the last 50 years. However, treatments like radiation or chemotherapy are damaging to human health and result in a wide range of negative side effects. Cranial radiation for example, causes an array of cognitive deficits such as verbal intelligence decline or slower processing speed.1 These types of problems can manifest for years post treatment and cause a range of social, physical and emotional difficulties. Traditional medical survival endpoints ignore these factors. Given this reality, and the increasing number of survivors, it is unsurprising that best practice in oncology has moved towards including the Quality of Life (QoL) monitoring of patients during and post treatment.2 The Qatar Government recognises this and in their Qatar National Cancer Strategy3 advise that ‘the goal of specialised care is achievement of the best quality of life for patients and their families with good symptom management during treatment and at end of life’.
Quality of life is defined as an “individuals’ perceptions of their position in life, in the context of the culture and value systems in which they live, and in relation to their goals, expectations, standards and concerns”.4
The impact of a cancer diagnosis extends to all those in a patients extended social network. This is especially true for children where cancer procedures produce a great deal of anxiety and distress, as well as pain and physical discomfort. One-third of children who undergo treatment will suffer from moderate or severe side effects.6 and several studies report that the QoL for children under treatment is poor.7,8 Normal psychological functioning can be disrupted and day-to-day living and development perturbed. Reduced motor functioning and autonomy, impaired emotional processing (anxiety, depression) and cognitive problems are common weeks or years after diagnosis. The developmental stages that young people go through make the effects of treatment especially problematic. For example, adolescence is a difficult time and results in a range of psychosocial issues even during normal development (e.g. high suicide rates). Adding a potentially life threating disease to this already complicated developmental stage is potentially of significance. Careful monitoring of the QoL of children, teenagers and young adults (CTYA) therefore, is essential. In doing so it is possible to understand the unique problems young people face with a view to intervention and improved survival.
Sixty CTYA constituting 25% of all CTYA oncology patients in Qatar, were given the PedsQL questionnaire (Varni 1998). PedsQL is given to patients and their parents and uses a 5-point Likert scale to ask about physical, emotional, social and school/work functioning. Means and SDs were calculated for each domain as well as psychosocial, physical and overall QoL. In some domains we found one third of patients had poor QoL or were at risk (e.g. 36% were suffering physically). Parents also underestimated their children's emotional well-being. We show how these findings informed the development of a number of interventions and in forming the QoL Clinic at Hamad, the first such dedicated clinic in the Gulf region.
-
-
-
Defining genetic modulators of intratumoral immune response in breast cancer through a system biology approach
Breast cancer is the most common type of tumor in women in the MENA region and it represents about 20% of the cancers diagnosed every year in Qatar. Although the implementation of cancer therapy has led to an improvement of patients' survival, metastatic breast cancer remains an incurable condition. Immunotherapy is emerging as an innovative therapeutic tool able to cure in some cases established metastatic tumors such as melanoma. There is a growing interest in exploring this fascinating approach in breast cancer. However, little is known about the immune biology of this aggressive disease. Studies from our and other groups have described intratumoral immune gene signatures associated with better responsiveness to immunotherapy and prolonged survival (Galon, Angell, Bedognetti and Marincola, Immunity 2013; PMID: 23890060). In general, these gene signatures imply the activation of interferon stimulated genes (e.g. IRF1 and STAT1), the recruitment of lymphocytes through CXCR3/CCR5 ligand chemokines, and the activation of immune-effector functions such as PRF1 and GZM1 (Wang, Bedognetti, Marincola, JCO 2013; PMID: 23715576). We refer to these genes as the Immunologic-Constant-of-Rejection (ICR) (Bedognetti, Wang, Sertoli, Marincola, Exp Rev Vacc, 2010; PMID: 20518712). The activation of the ICR pathways is accompanied by the counter-activation of immune-regulatory mechanisms such as the expression of PD-L1 and IDO1. Based on these observations, we hypothesize that tumors can be divided in two opposite phenotypes (Bedognetti, Hendrickx, Marincola, Miller, Curr Opin Onc 2015; PMID: 26418235). The first phenotype displays the activation of pro-inflammatory (ICR) and immune-regulatory mechanisms and is characterized by a favorable prognosis and responsiveness to immune manipulations. The second phenotype lacks these two characteristics and is associated by a poor prognosis and resistance to immune manipulations. Whether the development of such different immune phenotypes is influenced by the intrinsic genetics of the tumor cells is presently unclear. The understanding of genetic mechanisms associated with differential immune response can lead the development of targeted approaches. To answer this critical question we analyzed copy number variation, exome and RNA sequencing data from the The Cancer Genome Atlas (TCGA) breast cancer dataset. By using consensus clustering analysis based on RNA-seq data of more than 1000 breast cancer samples, we defined four immunophenotypes characterized by progressive expression of the ICR genes (ICR1
-
-
-
Utility of Depression Screening Among Pregnant Women in Qatar
Authors: Madeeha Nasir and Margaret AltemusMajor depression during pregnancy is associated with significant morbidity for the mother and her offspring, so screening for depression is recommended during pregnancy. The Edinburgh Postnatal Depression Scale (EPDS) is widely use for screening during pregnancy, but has not been evaluated for this use in any Gulf Arab countries.
We administered the EPDS to a multiethnic group of 768 women who were 8-16 weeks pregnant, and attending prenatal clinics in Doha, Qatar. The EPDS was administered in Arabic, English or Urdu, and the MINI diagnostic interview was administered in the same language to all subjects at the same time to determine DSM-V diagnoses. Women who had major depression at conception were excluded from the study. The EPDS was also administered to subjects again in the second and third trimester, but the MINI diagnostic interview was administered selectively, to all women scoring over 9 on the EPDS.
The mean EPDS scores decreased from first to second trimester and were similar to studies of pregnant women from other countries. Rates of major depression were 9.4% in the first trimester, 3.6% in the second trimester and 2.5% in the third trimester, with a combined prevalence during pregnancy of 14.3% for major and 13.3% for minor depression. In our sample, among women with an EPDS score of 12 or greater only 8% had major depression in the first trimester, but 34% had major depression in the second and third trimesters. Urdu speaking women had lower EPDS scores in the first and second trimesters but similar rates of major depression compared to Arabic and English speaking women, suggesting that Urdu speakers may be less likely to endorse depression symptoms on the EPDS.
In summary, screening for depression using the EPDS with follow up clinical interviews is likely to be very low yield in the first trimester.
However, despite low rates of major depression in the second and third trimesters, high scores on the EPDS do identify a group a women with high risk of major depression, who would benefit from a clinical evaluation and treatment if major depression is confirmed.
-